ID: 1142806881

View in Genome Browser
Species Human (GRCh38)
Location 17:2376000-2376022
Sequence CTGTGGGGATGCTGAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 10, 3: 53, 4: 489}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142806881_1142806893 22 Left 1142806881 17:2376000-2376022 CCCATTTCTCAGCATCCCCACAG 0: 1
1: 0
2: 10
3: 53
4: 489
Right 1142806893 17:2376045-2376067 CCGTTTTGCTGCATTTCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 168
1142806881_1142806889 -3 Left 1142806881 17:2376000-2376022 CCCATTTCTCAGCATCCCCACAG 0: 1
1: 0
2: 10
3: 53
4: 489
Right 1142806889 17:2376020-2376042 CAGGACTCGCTCTGGTCTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 168
1142806881_1142806890 20 Left 1142806881 17:2376000-2376022 CCCATTTCTCAGCATCCCCACAG 0: 1
1: 0
2: 10
3: 53
4: 489
Right 1142806890 17:2376043-2376065 TTCCGTTTTGCTGCATTTCTTGG 0: 1
1: 0
2: 2
3: 37
4: 326
1142806881_1142806891 21 Left 1142806881 17:2376000-2376022 CCCATTTCTCAGCATCCCCACAG 0: 1
1: 0
2: 10
3: 53
4: 489
Right 1142806891 17:2376044-2376066 TCCGTTTTGCTGCATTTCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 227
1142806881_1142806888 -4 Left 1142806881 17:2376000-2376022 CCCATTTCTCAGCATCCCCACAG 0: 1
1: 0
2: 10
3: 53
4: 489
Right 1142806888 17:2376019-2376041 ACAGGACTCGCTCTGGTCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142806881 Original CRISPR CTGTGGGGATGCTGAGAAAT GGG (reversed) Intronic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
901322985 1:8350596-8350618 CTGTGTGGAAGCTGAGATGTGGG - Intergenic
902573897 1:17364828-17364850 TGGTGAGGATGTTGAGAAATTGG + Intergenic
904273077 1:29363103-29363125 CTGTGGGGATCCTGTGGAAAAGG + Intergenic
904274799 1:29374128-29374150 TTTTGGGAATGGTGAGAAATAGG + Intergenic
904378686 1:30097074-30097096 CTGTGGTGGTGTTGAGAAATTGG + Intergenic
905032929 1:34899831-34899853 CTTTGGGGGTTCTGAGGAATAGG - Intronic
905265471 1:36751492-36751514 TTGTGAGGATGCTGAGAAACTGG + Intergenic
905972124 1:42150180-42150202 CAGTGGAGATGATGAGAAACGGG + Intergenic
906152381 1:43595080-43595102 CTGTGTGGGTGCTGAGAATGTGG + Intronic
906436989 1:45804202-45804224 GTCTGGGGAGGCCGAGAAATGGG + Intronic
907234560 1:53033677-53033699 TTGTGAGGATGTGGAGAAATTGG + Intronic
909309046 1:74122216-74122238 CTGAGAGGATGTGGAGAAATAGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
913174090 1:116257942-116257964 CAGTGAGGATGTGGAGAAATTGG + Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
914218911 1:145659568-145659590 TGGTGGGGATGTGGAGAAATTGG - Intronic
914356759 1:146892283-146892305 CTGTGGAGAAGCAGAAAAATGGG + Intergenic
914471494 1:147982443-147982465 TGGTGGGGATGTGGAGAAATTGG - Intronic
915024656 1:152816461-152816483 CTGTAGACATGCTGAGAATTTGG - Intergenic
915754710 1:158248755-158248777 GGCTGGGGGTGCTGAGAAATTGG - Intergenic
915897594 1:159823864-159823886 TTTTGGGGAAGCTGAGAAAGGGG - Intergenic
916348946 1:163826988-163827010 ATGTGGGGAGGTTGGGAAATGGG + Intergenic
916380074 1:164199970-164199992 CTGAGAGGATGTGGAGAAATAGG + Intergenic
916498753 1:165368636-165368658 CTGTCTTGAAGCTGAGAAATGGG + Intergenic
917039860 1:170792828-170792850 CTTTGGGGAGGCTGAGGACTAGG + Intergenic
917205191 1:172564208-172564230 CAGTGGGGATGCTGGGGATTGGG - Intronic
918158948 1:181879170-181879192 CTGTGAGGTTGCAGAGAAAAAGG - Intergenic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918381216 1:183957351-183957373 CTCTGGGGATGATGTGGAATGGG - Intronic
918422510 1:184378347-184378369 TTGTGAGGATGCAGAGAAATGGG + Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
921662457 1:217821153-217821175 GTGTGGCGATGTTGAGAGATGGG - Intronic
922639317 1:227211271-227211293 CTGGGGGGATGCAGATAAAAAGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923551131 1:234964555-234964577 CTGTGTGCATTCTGTGAAATGGG - Intergenic
924001506 1:239558117-239558139 TTGTGAGGTTGCAGAGAAATAGG - Intronic
924484744 1:244470521-244470543 TCGTGGGGATGTAGAGAAATGGG + Intronic
924487492 1:244499977-244499999 TGGTGAGGATGCAGAGAAATAGG - Intronic
1062933935 10:1371818-1371840 TTGTGTGGATGCAGAGAAAAGGG + Intronic
1062955437 10:1537320-1537342 CAGTGAGGATGTGGAGAAATTGG + Intronic
1063281634 10:4635866-4635888 CACTGGAGATGCTGAGAATTTGG - Intergenic
1063797563 10:9530022-9530044 TGGTGGGGATGCGGAGAAAAGGG + Intergenic
1064968449 10:21038844-21038866 TGGTGAGGATGCGGAGAAATAGG - Intronic
1065629609 10:27664630-27664652 CTGTGGGATTGCTGAGTAATTGG + Intergenic
1066520950 10:36218291-36218313 TTGTTGAGATGTTGAGAAATAGG + Intergenic
1067332375 10:45334071-45334093 CTGTGGGGAGGCTGACAAGATGG - Intergenic
1069414351 10:68184836-68184858 CTGGGAGTATGCTGAGAAGTGGG + Intronic
1070372609 10:75797950-75797972 TTGGGGGGATGTAGAGAAATTGG - Intronic
1070589066 10:77788771-77788793 CTGTGGGGTTGATGAGACACAGG - Intergenic
1071645166 10:87356145-87356167 CTGTGGGGATGCTCAGACAGCGG + Intergenic
1071956184 10:90762268-90762290 TCGTGAGGATGCTGAGAAAAGGG - Intronic
1072667693 10:97406260-97406282 CAGTGGGAAGGCTGAGAAAAGGG + Intronic
1073094801 10:100972933-100972955 CTGTGAGGATGCTGAGGAGGAGG - Exonic
1073170580 10:101504525-101504547 CAGTGGGGTTGGTGAGAGATGGG - Intronic
1073856935 10:107687151-107687173 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1073940133 10:108688023-108688045 TTGCAAGGATGCTGAGAAATTGG + Intergenic
1074291120 10:112138650-112138672 GGGTGGGGACGCAGAGAAATGGG - Intergenic
1074445511 10:113518117-113518139 CTGTGGGGCTGCAGAGAGTTGGG + Intergenic
1074940598 10:118232876-118232898 ATGTGTGGATTGTGAGAAATGGG + Intergenic
1076499035 10:130921320-130921342 CTGTGTGGATACTGACAAACTGG - Intergenic
1076502936 10:130951104-130951126 CTGTGGCTATGTTGAGAATTAGG + Intergenic
1077204250 11:1334462-1334484 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1077997194 11:7464205-7464227 CTGGGGGAATCCAGAGAAATGGG + Intronic
1078189632 11:9081966-9081988 CTGTGAGGATGTGGAAAAATTGG - Intronic
1078259489 11:9691367-9691389 CAGTGAGGATGCAGAGACATTGG + Intronic
1078515876 11:12022124-12022146 TGGTGAGGATGCGGAGAAATCGG + Intergenic
1079114864 11:17634603-17634625 CTTTGGGGTTGCTGTGAGATGGG + Intronic
1079743563 11:24096233-24096255 TGGTGAGGATGCGGAGAAATTGG - Intergenic
1079869145 11:25774280-25774302 CGGTGAGGATGTAGAGAAATTGG - Intergenic
1081118642 11:39236269-39236291 CTGAGAGGATGTGGAGAAATAGG + Intergenic
1081929234 11:46857228-46857250 ATGTGGGGAGGCTCAGAACTGGG + Exonic
1083577954 11:63806011-63806033 CTGTGGGGATATTGAAATATGGG - Intergenic
1084101598 11:66953234-66953256 CTGCGGAGATGCAGAGAAAGCGG - Intronic
1084331391 11:68432658-68432680 AGGAGGGGATGCTGGGAAATCGG - Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085632648 11:78132016-78132038 GTGGGAGGATGGTGAGAAATGGG - Intronic
1086520546 11:87663626-87663648 CTCTGTGGATGCTGAGAAGTGGG + Intergenic
1087556017 11:99721989-99722011 TGGTGGGGTTGCTGAGAAAAGGG + Intronic
1088197411 11:107290722-107290744 TGGTGAGGATGTTGAGAAATGGG - Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089443219 11:118532793-118532815 CAGAGGGGATGCTGAGGAACAGG - Intronic
1090338570 11:125993865-125993887 TTGTAGAGATGCTGAGAAATTGG - Intronic
1090463090 11:126909416-126909438 CTGTGGGTATGCTGGGAGCTGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1091661432 12:2386763-2386785 CTGCTGGGATGCAGAGAAACAGG - Intronic
1091764911 12:3113412-3113434 CTGAGGCCATGATGAGAAATTGG + Intronic
1091792497 12:3279998-3280020 CTGTGGGGAAGCTGTGTAGTGGG + Intronic
1092794503 12:12096738-12096760 CGGTGAGGATGTGGAGAAATTGG + Intronic
1093136185 12:15454209-15454231 TGGTGGGGATGTGGAGAAATTGG - Intronic
1093724142 12:22483731-22483753 ATGTGGGGAGGTTGAGAAAGAGG + Intronic
1094290524 12:28843085-28843107 TTCTGAGGATGCAGAGAAATTGG - Intergenic
1095282062 12:40364075-40364097 CTGTGCTGGTGCTGAGAAACAGG + Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1097032909 12:56102305-56102327 CTGTGAAGAAGCTGAGGAATGGG - Exonic
1098718388 12:73861658-73861680 GTGTGGGGATGGCGCGAAATGGG + Intergenic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100626812 12:96343323-96343345 TTGTGGCAAAGCTGAGAAATGGG - Intronic
1101606991 12:106254702-106254724 CTGTGGAGGTCATGAGAAATGGG - Intronic
1102496155 12:113320785-113320807 TTGTGGGGAGGCTGGGAGATAGG - Intronic
1102570561 12:113824792-113824814 CCGTGGAGATGATGAGAAACGGG - Intronic
1103852328 12:123941230-123941252 CTGTGGGAATGCAGAGGAACAGG - Intronic
1103916731 12:124379596-124379618 CTCTGGGGTTGCTGAGAAAGAGG + Intronic
1103997572 12:124840034-124840056 TGGTGAGGATGCGGAGAAATCGG - Intronic
1104073282 12:125366395-125366417 TGGTGAGGATGCTGAGAAAGAGG - Intronic
1104472193 12:129038189-129038211 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1104497263 12:129252549-129252571 CTGAGAGGATGTGGAGAAATAGG + Intronic
1106043323 13:26114862-26114884 CTGTGAGGGTGCTCAGAATTTGG - Intergenic
1106153531 13:27130083-27130105 CTCTGGGGATGCTGAGGAGTAGG - Intronic
1106155536 13:27152011-27152033 CAATGGGGATGCAGAGAAATGGG + Intronic
1106372848 13:29153429-29153451 AGGTAGGGATGCTGAGAAACAGG - Intronic
1107131507 13:36901308-36901330 CAGTGAGGATGTAGAGAAATTGG - Intronic
1107818863 13:44268203-44268225 CTTTGGAAATGCTGAGATATAGG - Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108544889 13:51482870-51482892 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1108549725 13:51531866-51531888 CTGAGAGGATGTGGAGAAATAGG + Intergenic
1108638223 13:52357256-52357278 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1109889617 13:68591633-68591655 TAGTAGGGATGCAGAGAAATAGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110477310 13:75931453-75931475 CTCTGGAGATGCTGAGTAAGAGG + Intergenic
1110727887 13:78847078-78847100 CTGTGCTGATGCTGAGAACGAGG - Intergenic
1111454462 13:88462218-88462240 GTGTGGGGATGTTGATAATTGGG - Intergenic
1111478810 13:88793748-88793770 CTGTGGGGAAGGTTAGAATTTGG + Intergenic
1112405456 13:99115887-99115909 CTGGAGGGATGTGGAGAAATAGG + Intergenic
1113042366 13:106119014-106119036 CTGTGGGAATGCTGTCAGATAGG - Intergenic
1113080043 13:106509845-106509867 CTGTAGGGTGGGTGAGAAATTGG + Intronic
1114361019 14:21972801-21972823 CGGTGAGGATGTAGAGAAATAGG + Intergenic
1114848401 14:26352179-26352201 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1116088006 14:40266294-40266316 CTGAGGGGATGTGGAGAAATAGG + Intergenic
1116183752 14:41569570-41569592 TTTTGGGGATGCAGGGAAATAGG + Intergenic
1117003287 14:51393551-51393573 CTGTGGGAATGCTGGGCCATGGG - Intergenic
1117825695 14:59701177-59701199 GTGTGAGGATGTGGAGAAATTGG + Intronic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118903126 14:70002985-70003007 CTGTAGGGTGGCTGAGAATTTGG - Intronic
1119182470 14:72614166-72614188 CCCTGGGAATGCTCAGAAATGGG + Intergenic
1119320854 14:73729549-73729571 CTGTGGGGCTGCTGGGGATTGGG - Intronic
1119409722 14:74423035-74423057 CGGGGGGGCTGCTGAGAAAGAGG - Intronic
1120064357 14:80022693-80022715 CTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1120321406 14:82966317-82966339 ATGTGAGGAAGCTGAGAAAAAGG - Intergenic
1120619441 14:86745660-86745682 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1120791556 14:88588489-88588511 CAGTGTTGATGCTGAGAACTTGG + Intronic
1121323740 14:93007771-93007793 CTGCGGGCATGCTCAGAAGTGGG + Intronic
1122373779 14:101244423-101244445 CGGTGAGGATGGTGAGAAACTGG - Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126930890 15:53649803-53649825 TTGTGAGGATGTAGAGAAATTGG + Intronic
1127814111 15:62591681-62591703 ATGTGGGGATGCTGAGAGCCAGG + Intronic
1128993999 15:72283377-72283399 CTGTGTGGAAGGGGAGAAATGGG - Intronic
1129468324 15:75736753-75736775 CTGTGGGGAGGGTGAGGCATAGG - Intergenic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129688474 15:77699814-77699836 CACTGGGGATGCTGAGGACTGGG - Intronic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130144316 15:81261692-81261714 CAGTTGGGATTCTGAGAATTGGG - Intronic
1130555914 15:84922471-84922493 CTGTGGGAATGCTGATAGATTGG - Intronic
1130556551 15:84926893-84926915 CCCTGGGGATGATGAGAGATGGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131005639 15:88975484-88975506 CTGTGAGAATTCTGAGAAAAGGG - Intergenic
1131660530 15:94510855-94510877 TTGTGGGGTTGCTGAAATATAGG - Intergenic
1131878774 15:96839702-96839724 CAGTGAGGATGTGGAGAAATTGG + Intergenic
1132067109 15:98740814-98740836 TTGTGGGGATGCCAAGGAATGGG - Intronic
1132307881 15:100830799-100830821 CTGTGGGGTGGCCGAGAACTGGG + Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1133722627 16:8509014-8509036 CGGTGGGGCTGCGGAGAAAAGGG + Intergenic
1133730950 16:8578104-8578126 GTGTGAGGATGCAGAAAAATAGG + Intronic
1134124178 16:11605173-11605195 CTGGGGGGATGCTGAGAGCTTGG - Intronic
1134772209 16:16819082-16819104 CTGTGGGGATGTTGATAATAAGG - Intergenic
1134883108 16:17764772-17764794 CTGTGGCAAAGCAGAGAAATAGG - Intergenic
1135141401 16:19925191-19925213 CAGTGAGGATGTTGAGAAATAGG - Intergenic
1136001269 16:27295798-27295820 GGGTTGGGATGTTGAGAAATTGG - Intergenic
1136158422 16:28401467-28401489 CTGTGGGGAGGCTGGGTGATAGG - Intronic
1136204665 16:28713816-28713838 CTGTGGGGAGGCTGGGTGATAGG + Intronic
1137374232 16:47938910-47938932 TGGTGAGGATGCTGAGAAAAAGG + Intergenic
1137858045 16:51816478-51816500 TGGTGAGGATGCTGAGAAAAAGG - Intergenic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1138755116 16:59475187-59475209 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1139977255 16:70823170-70823192 CTGTGGAGAAGCAGAAAAATGGG - Intronic
1140169278 16:72586290-72586312 CTGAGAGGATGTGGAGAAATAGG + Intergenic
1140791638 16:78397738-78397760 CTGAGGTGATCCTGAGAAAAAGG - Intronic
1141248356 16:82331986-82332008 CTGTGGGGATGCACAGAAAAGGG + Intergenic
1141388224 16:83642641-83642663 CGGAGAGGATGCGGAGAAATAGG + Intronic
1142183601 16:88684013-88684035 CTGTGAGGATGAGGAGGAATAGG + Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1144328409 17:14203787-14203809 CTGTGGGAATGTTCAGAAAAAGG - Intronic
1144939707 17:18929994-18930016 CTGGAGGGATGCAGAGAAACTGG - Intronic
1145065915 17:19761275-19761297 TTGTGAGGATGTGGAGAAATTGG - Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1149391322 17:56194130-56194152 TTGTGGGGATGTGGAGCAATAGG + Intronic
1149648490 17:58258715-58258737 CCGTCAGGATGCTAAGAAATTGG - Intronic
1149796032 17:59520954-59520976 TGGAGAGGATGCTGAGAAATTGG - Intergenic
1150539358 17:66080520-66080542 CTGGGAGGATGTGGAGAAATAGG + Intronic
1150582508 17:66487653-66487675 TGGTGGGGATGCAGAGAAAAGGG - Intronic
1150979916 17:70129460-70129482 CATTGGGTAGGCTGAGAAATGGG + Intronic
1151224561 17:72638982-72639004 CTGTGGGGATGCTGGGATACAGG + Intergenic
1151338796 17:73456545-73456567 GTGTGGGCATGCTGAGAGAATGG + Intronic
1151763417 17:76120314-76120336 CCTTGGGTAAGCTGAGAAATTGG - Intronic
1152369073 17:79874111-79874133 TGGTGGGGATGCACAGAAATAGG - Intergenic
1153474672 18:5486304-5486326 TTCTGTGGATGGTGAGAAATAGG - Intronic
1155445371 18:25906257-25906279 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1157563777 18:48666084-48666106 TGGTGGGGATGTGGAGAAATTGG - Intronic
1160190081 18:76708464-76708486 CTGTGGGGATGCGGAGAGTGTGG - Intergenic
1161903311 19:7136059-7136081 CGGTGAGGATGAGGAGAAATCGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162614827 19:11790490-11790512 CTGTGAGGATGTAGAGAAAAAGG + Intergenic
1162670532 19:12253734-12253756 CTTTGGGGATGCTGAGGTAGGGG + Intronic
1162731504 19:12721508-12721530 ATCTGGGGAAGCTCAGAAATTGG - Intronic
1163207955 19:15817711-15817733 CTGGGAGGATGCTGAGAAAAGGG - Intergenic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1165345534 19:35246804-35246826 TGGTGGGGATGTGGAGAAATTGG + Intergenic
1166559766 19:43724596-43724618 CAGTGGAAATGCTGAGAAATTGG + Intergenic
1167497903 19:49830163-49830185 CTGGGGGGCTGCTGAGAGAGTGG - Exonic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167650895 19:50728046-50728068 CTGTGGGCATGCAGAGAGAGAGG + Intergenic
1167724982 19:51205247-51205269 CGGTGAGGATGTGGAGAAATTGG + Intergenic
1167752075 19:51387450-51387472 CTGTGGGGAAGGGGAGAGATGGG + Intronic
1168075201 19:53977579-53977601 CTGTGGGGATGGGGAGAGAGAGG - Intronic
1168429778 19:56269260-56269282 TTGAGGGGATGTGGAGAAATTGG - Intronic
925182996 2:1829151-1829173 CTCTGGGGGTGCTGAGGACTGGG + Intronic
925993471 2:9272192-9272214 TTGTGGGGATGTGGAGAAAAGGG - Intronic
925994007 2:9276973-9276995 CTGTGGGGAGGCTTAGAAAGAGG + Intronic
926426824 2:12745880-12745902 CTTTGGGGATGGTGACAACTGGG - Intergenic
926635388 2:15173611-15173633 CTGATGGTATGCTGAGAAAATGG - Intronic
927841128 2:26444885-26444907 TTCTGGGGCTGCTGAGAAATAGG - Exonic
928034642 2:27810738-27810760 AAATGGGGATGCTGAGAAGTGGG - Intronic
929305834 2:40360561-40360583 CTGTAGGGTTGCTGAGAATGAGG - Intronic
929337648 2:40769731-40769753 TGGTGATGATGCTGAGAAATGGG - Intergenic
929348080 2:40911646-40911668 TTGTGAGGATGCAGAGAAAGTGG - Intergenic
930253266 2:49060195-49060217 CGGTGAGGATGCAGAGAAAAAGG + Intronic
930363805 2:50413539-50413561 CTGTGAGGATGTGGAGAAAAGGG + Intronic
930990529 2:57648894-57648916 TGGTGAGGATGCGGAGAAATAGG - Intergenic
931527349 2:63171539-63171561 TGGTGAGGATACTGAGAAATTGG + Intronic
932407658 2:71524479-71524501 CTTTGGGCATGCTGTGATATGGG + Intronic
932488813 2:72105305-72105327 CTGTGGGGAGGCTGGGAAGCAGG - Intergenic
933097139 2:78199607-78199629 CTGTTGAAATGCTGAGAACTTGG - Intergenic
933698105 2:85235422-85235444 CTCTGGGGATGCTGGGAATGTGG + Intronic
933813448 2:86047787-86047809 CTGGGGAGATGCTGAGAAGGGGG + Intronic
934703211 2:96460216-96460238 CGGTGAGGATGTGGAGAAATAGG + Intergenic
935551186 2:104457113-104457135 CAGTGAGGATGCAGAGAAACTGG - Intergenic
935974891 2:108568655-108568677 AGGTGGGGATGTGGAGAAATTGG - Intronic
936845344 2:116824384-116824406 CTGAGAGGATGTGGAGAAATAGG + Intergenic
937436832 2:121887991-121888013 CTATGGGGATGCTGAGAAGTGGG + Intergenic
937961371 2:127462566-127462588 GTGTGAGGATGTGGAGAAATGGG + Intronic
938147130 2:128844879-128844901 CGGTGAGGATGCGGAGAAATGGG - Intergenic
938464069 2:131515491-131515513 CTGTGGGGAAGCAGAGCAACTGG + Intergenic
938611033 2:132948012-132948034 CTGTGAGGATGCTGAGAAGTTGG - Intronic
938661064 2:133487743-133487765 CTGAGAGGATGGTGAGAAAGTGG + Intronic
939505723 2:143044466-143044488 CTGAGAGGATGTGGAGAAATAGG - Exonic
940189375 2:151023542-151023564 CTATGAGGATGCAGAGAAAGGGG + Intronic
940295110 2:152114516-152114538 CAGTGAGGATGTGGAGAAATTGG + Intergenic
940412602 2:153383288-153383310 CTATGTGGATGCCGAGAAACTGG - Intergenic
940651356 2:156443977-156443999 CTGCAGGGATGCTCAGAAGTAGG - Intronic
940692822 2:156940850-156940872 CTGCAGGGATGTTGAGAAAGAGG - Intergenic
941092919 2:161198775-161198797 CATTTGGCATGCTGAGAAATTGG + Intronic
941459703 2:165754543-165754565 CTGTGGGACTTCTGAAAAATAGG + Intronic
941608597 2:167632427-167632449 CAGAGAGGATGTTGAGAAATAGG - Intergenic
941720113 2:168803473-168803495 CTGTGGGGCGGCAGATAAATGGG + Intronic
941870039 2:170374371-170374393 GTGAGGGGATGATGAGAAAAGGG + Intronic
942998787 2:182298531-182298553 CTGTTGGGGTTCTAAGAAATTGG - Intronic
943848363 2:192681390-192681412 TTGTTGGGATGTGGAGAAATTGG - Intergenic
943901676 2:193446684-193446706 CAGTGAGGATGCAGAGAAAAAGG - Intergenic
943980552 2:194544344-194544366 CTGGGAGGATGTGGAGAAATAGG + Intergenic
944453517 2:199869665-199869687 CTGTGTGGAGGCTGAGATTTTGG - Intergenic
945013725 2:205492018-205492040 CTGTGGGCAACCTGAGAAACTGG - Intronic
945332308 2:208553822-208553844 ATGTGAGGATGCAGAGCAATGGG + Intronic
945503947 2:210614532-210614554 TGGAGAGGATGCTGAGAAATAGG - Intronic
945618334 2:212101935-212101957 CTGTGAGAATGCAGACAAATTGG - Intronic
947968271 2:234300659-234300681 ATGTGGAGATGCGGAGAAAAGGG + Intergenic
1169220939 20:3822360-3822382 GAGTGGGGACGCAGAGAAATAGG + Intronic
1169761640 20:9101322-9101344 CTGAGGGGATGGTGAGAGACAGG + Intronic
1170813245 20:19691647-19691669 CTGTGGGGATGATGAGATGGTGG + Intronic
1170964443 20:21053404-21053426 CTGGGGGCATGCTGAGACAAAGG + Intergenic
1171796246 20:29568704-29568726 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1171851991 20:30315463-30315485 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1172382511 20:34507216-34507238 ATGTGAGGATGTGGAGAAATTGG - Intronic
1173863187 20:46297478-46297500 CTGTGGAGATTCTGGGGAATTGG + Intronic
1174437830 20:50523759-50523781 CTGTGGGGATGCTCAGGAAAAGG + Intronic
1174530918 20:51213293-51213315 CACTGGGGTTGCTGAGAAGTGGG - Intergenic
1175041439 20:56055397-56055419 CAGAGAGGATGCAGAGAAATAGG + Intergenic
1175753208 20:61513434-61513456 CTGTGGGGTTGCTGTGAGGTTGG - Intronic
1176015903 20:62932116-62932138 CTTTGGGGAGGCTGAGACAGGGG - Intronic
1177681767 21:24380322-24380344 CCGTGAGGATGTGGAGAAATAGG - Intergenic
1178104604 21:29303924-29303946 CAGTGGGCATGCAGTGAAATTGG + Intronic
1178395926 21:32243564-32243586 CGGTGAGGATGCAGAGAAACTGG + Intergenic
1179327351 21:40360948-40360970 CTGTGAGGGTGCAGAGAAAAGGG - Intronic
1179366571 21:40764458-40764480 TGGTGAGGATGCAGAGAAATAGG + Intronic
1179386924 21:40952088-40952110 TGGTGGGGATGCGAAGAAATTGG - Intergenic
1179479480 21:41668516-41668538 CTGTGAGGATTCTGTGAAACAGG - Intergenic
1181498914 22:23304702-23304724 CGGTGAGGATGTAGAGAAATGGG - Intronic
1181682011 22:24501849-24501871 CTGTGGGGTTGCTGAGAGGCAGG - Intronic
1182378265 22:29864770-29864792 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1183036199 22:35142673-35142695 TGGTGGGGATGTTGAGAGATGGG - Intergenic
1183952290 22:41358519-41358541 CTGGGGGAATGCGGAGAAAAGGG + Exonic
1184011284 22:41750554-41750576 GTGTGGGGAAGGTGAGAAATGGG + Intronic
1184993841 22:48188267-48188289 CTGCTGGGATGCTGAGGGATGGG - Intergenic
1185007832 22:48294362-48294384 GTGTGGGTATGCTCTGAAATGGG + Intergenic
1185190282 22:49432141-49432163 TTTTGGGGATGCAGATAAATCGG - Intronic
1185398564 22:50604604-50604626 GCGTGGGGTTGCTGAGGAATAGG - Exonic
949446244 3:4136980-4137002 CGGAGGGGATGTGGAGAAATAGG + Intronic
950097550 3:10338762-10338784 CTCTGGGCATGGTGAGAACTGGG + Intronic
950576561 3:13835514-13835536 CCATGGGGATGCAGAGCAATGGG + Intronic
951433330 3:22633633-22633655 CAGTGAGGATGTGGAGAAATTGG - Intergenic
951550209 3:23869790-23869812 CTGTGTGGAAACTGGGAAATTGG + Intronic
951875273 3:27417854-27417876 CGGTGAGGATGCAGGGAAATAGG + Intronic
952549006 3:34454741-34454763 TGGTGAGGATGCAGAGAAATAGG - Intergenic
952713866 3:36458444-36458466 CCGTTGGGATGATGAGAAAGAGG + Intronic
953122792 3:40061717-40061739 TTGTGAGGTTGCAGAGAAATGGG - Intronic
953267063 3:41400814-41400836 TAGGGGAGATGCTGAGAAATTGG - Intronic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953849485 3:46455071-46455093 CCGTGGGGCTGGTGAGAAGTTGG + Intronic
954436910 3:50501133-50501155 CTGTGGGGCTGCTCAGGGATGGG - Intronic
954667151 3:52261780-52261802 TGGTGAGGATGCAGAGAAATTGG + Intronic
955178457 3:56641742-56641764 CTGTGGAGACTCTGAGAAAAAGG + Exonic
955377762 3:58412248-58412270 ATGGGGAGATGCTGAGAACTTGG + Intronic
956022978 3:64951756-64951778 CTTTGGGGAAGCTGAGAAGAAGG + Intergenic
956042532 3:65159625-65159647 TTGTGAGGATGTGGAGAAATTGG - Intergenic
956339143 3:68201887-68201909 CAGTGGGGAAGCTGACACATAGG + Intronic
956839336 3:73122644-73122666 TGGTGAGGATGCAGAGAAATTGG + Intergenic
957162617 3:76629652-76629674 CTGTGAGGATGCTGTCAAAGGGG - Intronic
957481420 3:80801880-80801902 CAGTGAGGATGCAGAGAAAATGG + Intergenic
957545621 3:81632564-81632586 CTGGGAGGATGTGGAGAAATAGG + Intronic
958996345 3:100909776-100909798 CTGAGAGGATGTGGAGAAATAGG + Intronic
959268137 3:104169755-104169777 CTGTGGGGATGCTGCACAAAAGG + Intergenic
960173335 3:114488594-114488616 TAGTGAGGATGCAGAGAAATGGG + Intronic
961937435 3:130600223-130600245 TTGTGAGGATGTGGAGAAATAGG + Intronic
962147017 3:132850218-132850240 TGGTGGGGATGCAGTGAAATGGG - Intergenic
962289257 3:134118145-134118167 TGGTGAGGATGCTGAGAAAAAGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087446 3:141451271-141451293 TAGTGGGGATGGTAAGAAATGGG + Intergenic
963143516 3:141967924-141967946 CTGTTGGCATGCTGATAAACAGG + Intronic
963205739 3:142632438-142632460 CTGAGGGGATGCAGAGTGATTGG + Intronic
963390822 3:144661631-144661653 CTGTGAGGATGCAGAGCAATTGG - Intergenic
965287476 3:166835234-166835256 CGGTGAGGATGTGGAGAAATTGG - Intergenic
965802825 3:172512139-172512161 CTGTGGGCATCCTGAGAGAGAGG - Intronic
967076060 3:186003202-186003224 CTGTGGGGATGTGGTGAATTAGG + Intergenic
967420170 3:189263603-189263625 CTCTGGAATTGCTGAGAAATGGG + Intronic
970454317 4:16207076-16207098 CTGTGTGGCTGCTGAGAAGCAGG - Intronic
971147019 4:23988418-23988440 CTGGGGGAATGTGGAGAAATAGG - Intergenic
971530917 4:27687638-27687660 TGGTGAGGATGCAGAGAAATGGG - Intergenic
971602802 4:28617047-28617069 CTGTCTGGCTGCTGAGAACTTGG - Intergenic
972068526 4:34983721-34983743 CTGGGGGGATGCTGTCATATGGG + Intergenic
972257008 4:37367795-37367817 CAGTGAGGATGCTGAGACTTAGG + Intronic
972277149 4:37568095-37568117 CTGTAGGAATGCTGAGGAACAGG - Intronic
972790548 4:42367620-42367642 CTGTGGGGATAGTGAGAGCTTGG + Intergenic
973629583 4:52807508-52807530 TGGTGAGGATGCAGAGAAATAGG + Intergenic
974539381 4:63214139-63214161 CAGTGAGGATGCTGAGAAAAAGG - Intergenic
974568193 4:63606935-63606957 CTGTGGGGAGAATGAGAAACAGG - Intergenic
975265024 4:72353456-72353478 CTGTGTGGATGCTGAAAGAAAGG + Intronic
975380199 4:73691088-73691110 CTGAGAGGATGTGGAGAAATAGG + Intergenic
975869446 4:78762773-78762795 CTGTAGGTATGCTGATAGATAGG + Intergenic
976227012 4:82802333-82802355 CAGTGGGGATTTGGAGAAATTGG - Intergenic
976650473 4:87428829-87428851 CTGTGGGGATGTTGACAATGCGG - Intronic
978017734 4:103767975-103767997 CAGTGAGGATGTGGAGAAATTGG - Intergenic
979176216 4:117667279-117667301 TTGTGAGGATGTGGAGAAATAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980225966 4:129986119-129986141 CTGTGAGTATGCTAAGAAAGAGG + Intergenic
980849234 4:138360241-138360263 CTGAGAGGATGTGGAGAAATAGG + Intergenic
981002197 4:139838807-139838829 CTGTGGGGATGCTTTGAAAGTGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
982130908 4:152227891-152227913 CTGAGGGGAAGGTGTGAAATTGG - Intergenic
983129765 4:164003644-164003666 CTGTGAGGCTGTGGAGAAATAGG + Intronic
984030573 4:174599178-174599200 TGGTGAGGATGCTGAGAAAAGGG - Intergenic
985001034 4:185483305-185483327 CTGGGGGGTTGCGGTGAAATGGG - Intergenic
985157662 4:187007940-187007962 TGGTGAGGATGTTGAGAAATTGG - Intergenic
985501476 5:250352-250374 CTGTAGGTATGCTGGGAACTAGG - Intronic
985516628 5:348949-348971 CGGCGGGGATGCAGAGAAACTGG - Intronic
985715723 5:1459882-1459904 TAGTGGGGATGCTGAGAAGTGGG - Intronic
986346339 5:6838818-6838840 CAGTGGAGATGCTGAGAAGCAGG + Intergenic
987275636 5:16359511-16359533 CTGCAAGGATGCAGAGAAATAGG + Intergenic
987902827 5:24035767-24035789 CTGGGAGGATGTGGAGAAATAGG - Intronic
987903002 5:24037839-24037861 CTGGGAGGATGTGGAGAAATAGG - Intronic
989397274 5:40971218-40971240 TGGTGGGGATGTGGAGAAATAGG - Intronic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
990801863 5:59613140-59613162 CCATGGTGATGGTGAGAAATGGG + Intronic
991295132 5:65072501-65072523 GTGTGGGGAGGCTGAAGAATTGG + Intergenic
991539372 5:67709483-67709505 CTGAGAGGATGTGGAGAAATAGG + Intergenic
991546305 5:67785511-67785533 CTGAGAGGATGTGGAGAAATAGG + Intergenic
992198975 5:74365847-74365869 CAGTGGGGAAGCTGACAAACTGG + Intergenic
993413723 5:87601156-87601178 CAGTGGGTATGCTGAGCCATGGG + Intergenic
993884347 5:93398403-93398425 CTGTGGGGAGGCTGGGAATTTGG + Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
995406375 5:111801303-111801325 ATGTGGGGGTGCTGAGAGAGGGG + Intronic
995785491 5:115823199-115823221 TGGTGAGGATGCGGAGAAATAGG - Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
996412274 5:123171172-123171194 CTGTGGAGGTGCTCAGAAGTTGG - Intronic
996617220 5:125456527-125456549 TTGTGAGGATGTGGAGAAATAGG - Intergenic
997797223 5:136822394-136822416 CTTTGGGGATGCTGGGGAAAGGG - Intergenic
998869745 5:146540473-146540495 CTGTGTGTATGCTGAGAATAGGG + Intergenic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
999612835 5:153389067-153389089 CGGTGAGGATGTGGAGAAATTGG - Intergenic
1000322363 5:160144732-160144754 CGGTGAGGATGCAGAGAAAAGGG - Intergenic
1000464746 5:161561983-161562005 CTGTGCAGATGATGAGAAACAGG - Intronic
1000790205 5:165597381-165597403 CAGTCGGGATGTTGAGAAATGGG - Intergenic
1000819404 5:165965043-165965065 TGGTGAGGATGCAGAGAAATAGG - Intergenic
1001165269 5:169359788-169359810 TTGTGAGGATGCAGAGAAAAGGG + Intergenic
1002505430 5:179676186-179676208 CTTTTGGGCTGATGAGAAATTGG - Intergenic
1002527852 5:179824895-179824917 CTGTGGGGTTGCTGAGCACCAGG + Intronic
1003824513 6:9938312-9938334 CTGCGGGAATGCAGAGAACTGGG - Intronic
1004469216 6:15914030-15914052 TTGTGAGGATGTGGAGAAATTGG + Intergenic
1004883364 6:20030258-20030280 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1005136292 6:22571884-22571906 ATGTTTGGATGCTGACAAATTGG + Intergenic
1005922503 6:30415060-30415082 CTGAGGGTGGGCTGAGAAATAGG + Intergenic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1007110339 6:39310022-39310044 CTGTGGGGAGGCTGGGATACTGG + Intronic
1007117428 6:39353203-39353225 CAGTGAGGATGTTGAGCAATAGG - Intronic
1007388374 6:41534788-41534810 CTTTGAGGATGCTAAGACATGGG - Intergenic
1007438811 6:41839787-41839809 CTGTGAGGATGCAAAGACATAGG + Intronic
1007457743 6:41993287-41993309 CTGTGAGGATGAGGAGAAAAGGG - Intronic
1007461250 6:42020670-42020692 CTGTGGGAATTCTGAGAGAAGGG - Intronic
1007736670 6:43986368-43986390 CTGTGAGCATGCTGAGGAAGGGG + Intergenic
1008479465 6:51970071-51970093 TGGTGAGGATGCTGAGAAAGGGG - Intronic
1008795392 6:55296526-55296548 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1009785223 6:68328492-68328514 TTGTGAGGGTGCTGAGAAAGAGG + Intergenic
1010186252 6:73146513-73146535 CACTTGGGAGGCTGAGAAATGGG + Intronic
1010290064 6:74125285-74125307 GTTTGGGGATGTTGAGGAATGGG + Intergenic
1012680042 6:102168821-102168843 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1013715800 6:112960012-112960034 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1013753213 6:113431202-113431224 CTGTGGGGATTCTGAAGAGTAGG - Intergenic
1014344632 6:120252700-120252722 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1014577104 6:123086968-123086990 CTGTGGAGATCCTGAGAACATGG - Intergenic
1015090862 6:129356480-129356502 CAGTGGGGATGATAAGGAATGGG - Intronic
1015337383 6:132055729-132055751 CAGTGAGTATGTTGAGAAATGGG + Intergenic
1016424763 6:143922990-143923012 TTGTGAGGATGCGGAGAAAAGGG - Intronic
1017553929 6:155542624-155542646 TTGTGGGGATGAAGAGGAATTGG + Intergenic
1018001798 6:159586034-159586056 CTGGGGGGATGTGGAGCAATTGG + Intergenic
1018332310 6:162743006-162743028 TTGTGGGGATGTGGAAAAATGGG - Intronic
1018717956 6:166549180-166549202 CGGTGAGGATGCAGAGAAACTGG + Intronic
1021496986 7:21286115-21286137 CTGTGAGGATGTGAAGAAATTGG + Intergenic
1022040844 7:26579893-26579915 TTGCAGGGAGGCTGAGAAATGGG + Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1023692220 7:42801687-42801709 CTGGGAGGATGTGGAGAAATAGG + Intergenic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024588034 7:50857893-50857915 ATGGGGGGTTGCTGAGGAATGGG + Intergenic
1024855795 7:53777496-53777518 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1024888658 7:54176294-54176316 CGGAGGGACTGCTGAGAAATGGG - Intergenic
1027562754 7:79752657-79752679 TTGTGGGGATGCGGTGAAAAGGG - Intergenic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028716588 7:93978178-93978200 CTATGGGGAGGCTGAGAGATGGG - Intronic
1029492166 7:100876962-100876984 CTGTGGACATCCTGAGAAACAGG - Intronic
1029953107 7:104608004-104608026 CTGAGAGGATGTGGAGAAATAGG + Intronic
1030413320 7:109210133-109210155 TGGTGGGGATGCGGAGAAAAGGG - Intergenic
1031462945 7:122074112-122074134 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1031679676 7:124655962-124655984 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1031798537 7:126211173-126211195 TGGTGAGCATGCTGAGAAATTGG + Intergenic
1032607533 7:133371867-133371889 CAGTAAGGATGCAGAGAAATTGG - Intronic
1032941227 7:136794917-136794939 CTGTGAGGATGTGGAGAAAAGGG + Intergenic
1033936366 7:146590674-146590696 CTTTGGGGATGCTGAATAAATGG - Intronic
1034503610 7:151468064-151468086 CTGTGGGGCTTCTGAGAACAGGG - Intronic
1034701366 7:153099189-153099211 CTGAGGGGAGCTTGAGAAATGGG - Intergenic
1035551195 8:527726-527748 GTGTGTGTATGGTGAGAAATAGG - Intronic
1035616034 8:1002625-1002647 CTGTGGGGTGGCTGTGAAATGGG + Intergenic
1035725223 8:1820422-1820444 AAGTGGGATTGCTGAGAAATGGG + Intergenic
1036293071 8:7512130-7512152 TTGTGGGGCTGCTGAGAAAGTGG - Intergenic
1036329490 8:7808870-7808892 TTGTGGGGCTGCTGAGAAAGTGG + Intergenic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037494958 8:19429860-19429882 CTCTGAGGAGGCAGAGAAATTGG - Intronic
1038662330 8:29507779-29507801 TTGTGGGGATGTTGAGGCATTGG + Intergenic
1038664759 8:29528716-29528738 CTCTGGGGATGCTGATACAGGGG + Intergenic
1038708369 8:29918567-29918589 TGGTGTGGATGCTGAGAAAAAGG + Intergenic
1039186051 8:34917394-34917416 CTGTGGGAATGCTAATTAATAGG - Intergenic
1041168327 8:55114209-55114231 CTGTGAGGTTGCAGAGAAAAGGG - Intronic
1043135681 8:76521013-76521035 TGGTGAGGATGCAGAGAAATGGG - Intergenic
1043235001 8:77853461-77853483 TTGCGAGGATGCAGAGAAATGGG - Intergenic
1044377546 8:91494386-91494408 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1045317827 8:101058665-101058687 CTGTGGGGCTGCAGAGAGAGGGG - Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1047287569 8:123501246-123501268 CTTTGAGGAAGCTGAGAAATTGG + Exonic
1047368455 8:124234573-124234595 CTGTAGGGAGGCTGAGATATGGG - Intergenic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048475632 8:134740003-134740025 CTGGGGGGATTCTGAGAAATAGG - Intergenic
1048572324 8:135666449-135666471 CTATGTGGAAGCAGAGAAATAGG - Intergenic
1048681527 8:136847113-136847135 CTTTAAGAATGCTGAGAAATAGG - Intergenic
1049746732 8:144266252-144266274 CTCTGGGGATGCGGAGGAACTGG - Intronic
1051417638 9:16859209-16859231 CTGTGAGGTTGTAGAGAAATTGG + Intronic
1052458484 9:28731834-28731856 CTTGGGGGATGCTGGGAAAAGGG + Intergenic
1053789774 9:41678717-41678739 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054155367 9:61636036-61636058 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054178114 9:61890407-61890429 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054475153 9:65567147-65567169 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054659415 9:67690417-67690439 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1055355939 9:75436998-75437020 ATGTGCCCATGCTGAGAAATAGG - Intergenic
1056130378 9:83580139-83580161 TGGTGAGGATGCTGAGAAAAGGG + Intergenic
1056669647 9:88615514-88615536 CTGTGAGGTTGTGGAGAAATAGG - Intergenic
1057048433 9:91903657-91903679 CTTTGGGGATGTTGAGAATGTGG - Intronic
1057139168 9:92716467-92716489 CTGCAGGGATACTGAGAAACTGG + Intronic
1057492584 9:95533059-95533081 TGGTGGGGATGTGGAGAAATGGG + Intergenic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1058211509 9:102175098-102175120 CTTTGGATATGGTGAGAAATAGG + Intergenic
1058266482 9:102905238-102905260 CGGTGAGGATGCAGAGAAATAGG + Intergenic
1059647146 9:116279070-116279092 CAGTGGGGAAACTGAGAACTAGG - Intronic
1060003716 9:119981244-119981266 CTGAGGGGCTGCTGAGAATCAGG - Intergenic
1060168093 9:121436905-121436927 CTGGGAGGATGTGGAGAAATAGG + Intergenic
1062675123 9:137738413-137738435 CAGTGAGGATGCGGAGAAATGGG + Intronic
1203778290 EBV:86196-86218 CAGTGGGGCTTCTGAGAGATTGG + Intergenic
1186108686 X:6232471-6232493 CTATTGGGATGCTGAGAAAATGG + Intergenic
1186612901 X:11155820-11155842 GTGTGGGGATGCTGAGCATTTGG - Intronic
1186680904 X:11872890-11872912 CTGTGAGGATGTGGAGAAATTGG + Intergenic
1187119467 X:16390217-16390239 TTGTGAGGATGCAGAGAAATTGG + Intergenic
1187351342 X:18520708-18520730 TGGTGAGGATGTTGAGAAATTGG - Intronic
1187596468 X:20778029-20778051 TGGTGGGGATGCAGAGAAAGAGG + Intergenic
1187924875 X:24240558-24240580 TTATGGGGATACAGAGAAATTGG + Intergenic
1188202955 X:27315742-27315764 TTGTGAGGATGTGGAGAAATTGG + Intergenic
1188525529 X:31083854-31083876 CTGTGTGGTTGCAGAGAAAGGGG + Intergenic
1188999481 X:36928383-36928405 CTCTGGGGAAGCTCAGACATTGG - Intergenic
1189475904 X:41355423-41355445 TGGTGAGGATGCAGAGAAATTGG - Intronic
1189996177 X:46640892-46640914 TGGGGGGGATGCTGAGAAACTGG + Intronic
1190266538 X:48830595-48830617 CTCTGAGAAGGCTGAGAAATTGG - Intergenic
1190583211 X:51908853-51908875 CACTGGGGATGCGGAGAAATTGG - Intergenic
1191019592 X:55845023-55845045 TGGTGAGGATGCTGAGAAATAGG + Intergenic
1191042256 X:56095806-56095828 TGGTGGGGATGCAGAGAAAAAGG + Intergenic
1191145898 X:57165048-57165070 CTATGAGGATGTGGAGAAATAGG + Intergenic
1191218694 X:57961843-57961865 TTGTGAGGATGGGGAGAAATTGG - Intergenic
1191656644 X:63605657-63605679 CTTTGAGGTTGCAGAGAAATAGG + Intergenic
1191765179 X:64690600-64690622 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1191927654 X:66330825-66330847 ATGTGTGGTTTCTGAGAAATTGG + Intergenic
1192404256 X:70868384-70868406 TGGTGAGGATGCGGAGAAATAGG + Intronic
1192536318 X:71931032-71931054 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1192658500 X:73017974-73017996 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1193671466 X:84391583-84391605 TAGTGAGGATGCAGAGAAATAGG - Intronic
1193860550 X:86661325-86661347 CTTTGCGGATGCAGAGAAATGGG - Intronic
1195131492 X:101858382-101858404 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1195177510 X:102325289-102325311 CGGTGAGAATGCAGAGAAATTGG + Intronic
1195181354 X:102361804-102361826 CGGTGAGAATGCAGAGAAATTGG - Intronic
1195585049 X:106555504-106555526 TTGTGGGGATGTGGAGAAAAAGG + Intergenic
1197180346 X:123528959-123528981 CAGTGAGGATGCTGAGAAAAGGG - Intergenic
1197462339 X:126757761-126757783 CTGTGGAGATGCATAGATATTGG + Intergenic
1197939216 X:131771796-131771818 GGGTGGGGAGGCGGAGAAATTGG - Intergenic
1197958168 X:131975299-131975321 CGGTGGGGATGCGGTGAAAAGGG - Intergenic
1197973460 X:132139438-132139460 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1198031732 X:132759875-132759897 GTGTGGGGATTCAGTGAAATAGG - Intronic
1198036698 X:132808067-132808089 TTGTGGAGCTGCTGAGAAAATGG + Intronic
1198224655 X:134634029-134634051 CTGTGTAGATGCTCAGAAAGAGG - Intronic
1198662362 X:138983535-138983557 TAGTGAGAATGCTGAGAAATTGG + Intronic
1199041998 X:143125377-143125399 TTGTGGGGAAGTTGAGAAAAAGG - Intergenic
1199167242 X:144691299-144691321 TGGCGGGGATGCAGAGAAATAGG - Intergenic
1199664621 X:150086954-150086976 CTGTGGCCATGCTGAGACAAAGG - Intergenic
1199830252 X:151542410-151542432 TGGTGTGGATGCTGAGAAATTGG - Intergenic
1199932837 X:152541994-152542016 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1200907752 Y:8501974-8501996 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1201488711 Y:14518756-14518778 CTATTGGGATGATGAGAAAAAGG - Intergenic
1202370231 Y:24191255-24191277 CAGTGGTGCTGCAGAGAAATTGG + Intergenic
1202500553 Y:25478862-25478884 CAGTGGTGCTGCAGAGAAATTGG - Intergenic