ID: 1142810497

View in Genome Browser
Species Human (GRCh38)
Location 17:2393582-2393604
Sequence CGTGGTCCCCGTCCACGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 485}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142810497_1142810510 24 Left 1142810497 17:2393582-2393604 CCGCAGCGTGGACGGGGACCACG 0: 1
1: 0
2: 2
3: 58
4: 485
Right 1142810510 17:2393629-2393651 CAGACATTCGGGCGGAATCTGGG 0: 1
1: 0
2: 0
3: 2
4: 28
1142810497_1142810507 13 Left 1142810497 17:2393582-2393604 CCGCAGCGTGGACGGGGACCACG 0: 1
1: 0
2: 2
3: 58
4: 485
Right 1142810507 17:2393618-2393640 GCAGATAGCTACAGACATTCGGG 0: 1
1: 0
2: 0
3: 22
4: 122
1142810497_1142810509 23 Left 1142810497 17:2393582-2393604 CCGCAGCGTGGACGGGGACCACG 0: 1
1: 0
2: 2
3: 58
4: 485
Right 1142810509 17:2393628-2393650 ACAGACATTCGGGCGGAATCTGG 0: 1
1: 0
2: 0
3: 0
4: 31
1142810497_1142810506 12 Left 1142810497 17:2393582-2393604 CCGCAGCGTGGACGGGGACCACG 0: 1
1: 0
2: 2
3: 58
4: 485
Right 1142810506 17:2393617-2393639 CGCAGATAGCTACAGACATTCGG 0: 1
1: 0
2: 0
3: 8
4: 141
1142810497_1142810508 16 Left 1142810497 17:2393582-2393604 CCGCAGCGTGGACGGGGACCACG 0: 1
1: 0
2: 2
3: 58
4: 485
Right 1142810508 17:2393621-2393643 GATAGCTACAGACATTCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142810497 Original CRISPR CGTGGTCCCCGTCCACGCTG CGG (reversed) Intronic