ID: 1142812174

View in Genome Browser
Species Human (GRCh38)
Location 17:2400528-2400550
Sequence CTCCGCAGGCCGCCCGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 147}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142812158_1142812174 22 Left 1142812158 17:2400483-2400505 CCCTCCCCAGGCGGCGGCTCTCG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG 0: 1
1: 0
2: 3
3: 10
4: 147
1142812157_1142812174 23 Left 1142812157 17:2400482-2400504 CCCCTCCCCAGGCGGCGGCTCTC 0: 1
1: 0
2: 1
3: 24
4: 255
Right 1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG 0: 1
1: 0
2: 3
3: 10
4: 147
1142812161_1142812174 18 Left 1142812161 17:2400487-2400509 CCCCAGGCGGCGGCTCTCGCGGG 0: 1
1: 0
2: 3
3: 14
4: 97
Right 1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG 0: 1
1: 0
2: 3
3: 10
4: 147
1142812167_1142812174 -8 Left 1142812167 17:2400513-2400535 CCGTGCGCTGCCAGGCTCCGCAG 0: 1
1: 0
2: 0
3: 16
4: 214
Right 1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG 0: 1
1: 0
2: 3
3: 10
4: 147
1142812159_1142812174 21 Left 1142812159 17:2400484-2400506 CCTCCCCAGGCGGCGGCTCTCGC 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG 0: 1
1: 0
2: 3
3: 10
4: 147
1142812165_1142812174 16 Left 1142812165 17:2400489-2400511 CCAGGCGGCGGCTCTCGCGGGGA 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG 0: 1
1: 0
2: 3
3: 10
4: 147
1142812163_1142812174 17 Left 1142812163 17:2400488-2400510 CCCAGGCGGCGGCTCTCGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG 0: 1
1: 0
2: 3
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142812174 Original CRISPR CTCCGCAGGCCGCCCGGGAG GGG Intronic
900095957 1:940228-940250 CTCTGCTGGCCGCGCGGGGGAGG + Intronic
900384690 1:2404980-2405002 CCCAGCAGGCCCCCCAGGAGAGG + Exonic
903012878 1:20343416-20343438 CTCCGGAGGCCGTCCGCGGGAGG - Intronic
904137185 1:28322253-28322275 TTCCCCAGACAGCCCGGGAGGGG + Intergenic
904528963 1:31155445-31155467 ATCCGCGGGTGGCCCGGGAGAGG + Intergenic
905515305 1:38558217-38558239 CTCCGCTGGGCTCCTGGGAGTGG - Intergenic
906055915 1:42916947-42916969 CTCCGCACCCAGCCCTGGAGCGG - Intergenic
909001364 1:70221450-70221472 CGCCGCACGCCGCGGGGGAGGGG - Intronic
912491083 1:110063231-110063253 CTCAGCAGGCCTCCGGGGTGTGG - Intronic
915555253 1:156657597-156657619 CACCGCAGACCGCCCGGGAGCGG + Intronic
919463263 1:197902993-197903015 ACCCGGAGGCCGCCCGGCAGAGG + Intronic
922802746 1:228371697-228371719 CACCGCAGGCCTCCGAGGAGGGG - Exonic
1065021986 10:21508941-21508963 CTCCGCAGCCCTCTCGGGCGGGG + Intergenic
1066004463 10:31133971-31133993 CTCCTCAGGCTGCGGGGGAGGGG - Intergenic
1066489950 10:35884779-35884801 CTCTGCATGCAGCCCAGGAGAGG - Intergenic
1069913534 10:71773622-71773644 CTCCGAGGGCCGCGTGGGAGGGG + Intronic
1070257380 10:74824720-74824742 CTCCTCTGGCCGCCCAGGCGAGG - Intergenic
1070923855 10:80205401-80205423 CTCCGCGGGCGTCCCGGGCGCGG + Exonic
1074757242 10:116633098-116633120 CCCCGCAGACCCCCCAGGAGTGG + Intronic
1076156535 10:128210036-128210058 TTCCGCAGGCAGCACGGGACAGG - Intergenic
1076721660 10:132395957-132395979 CTCCGGCGGCCGCGCGGCAGTGG - Intergenic
1076734872 10:132454279-132454301 CTTCGCAGGCTGCCAGGGTGAGG + Intergenic
1076893428 10:133296362-133296384 CTCAGCAGGCAGCCGGGGAGTGG - Intronic
1078518860 11:12047532-12047554 CTCTGCAGGATGCCCAGGAGGGG + Intergenic
1079627748 11:22635569-22635591 GTCTGCAGGCCGACAGGGAGGGG - Intronic
1081969096 11:47186123-47186145 TTCCGCAGGCCGCCCGGGGGAGG - Intronic
1084371890 11:68750626-68750648 CTGGGCAGCCCGCCCGGCAGAGG + Exonic
1084530782 11:69726652-69726674 CTCCGCAGGTGCCCAGGGAGAGG - Intergenic
1084573593 11:69975003-69975025 CTACGGAGGCAGCCTGGGAGGGG + Intergenic
1088462236 11:110093516-110093538 CTCCGCCTGGCGCCCGGGCGCGG - Intronic
1090003978 11:122984280-122984302 CTCCGGCGGCAGCGCGGGAGCGG - Intergenic
1091251908 11:134151249-134151271 TGCCGCAGGCCGCCTGGCAGAGG + Exonic
1091563256 12:1630149-1630171 GTCCCCAGGCTCCCCGGGAGGGG - Intronic
1096548440 12:52356785-52356807 GTCCGCAGGCCACCTGGGTGGGG - Intergenic
1096845710 12:54405308-54405330 CTCCTGAGGCCGCCCGTCAGGGG + Exonic
1100611302 12:96194106-96194128 CTGCGCAGTTGGCCCGGGAGGGG - Intergenic
1109858876 13:68171331-68171353 CTCCACGTGCCGCCCGGGTGTGG + Intergenic
1113378997 13:109786299-109786321 GGCCGCAGGCAGCCGGGGAGGGG - Exonic
1114473887 14:22981295-22981317 TTCCGGAGGCCGCCCGGGCCCGG - Exonic
1119570029 14:75661681-75661703 CTCTGCAGGCAGCCTAGGAGAGG + Intronic
1120993362 14:90397563-90397585 CGCTGCAGGCAGCCCGGGTGCGG - Intronic
1121450016 14:94001137-94001159 CTCCGTAGGCTGCACGGGATGGG + Intergenic
1122077533 14:99245866-99245888 CTCCGCCGGCTGCCAGGGAAGGG + Intronic
1122877816 14:104677027-104677049 CTCCTCAGGCGGCCCTGGGGCGG - Intergenic
1123474920 15:20582576-20582598 ATCCGCAGGCCTCCCGGGCCAGG - Intergenic
1123643091 15:22417781-22417803 ATCCGCAGGCCTCCCGGGCCAGG + Intergenic
1125834446 15:42737144-42737166 CGCCGCGGGCGGCCAGGGAGGGG + Intergenic
1127912750 15:63431651-63431673 CTCCCCAGGCCTCCCTGCAGGGG + Intergenic
1129323490 15:74787518-74787540 CTCAGCAGGCCCCCAGGGACTGG + Intronic
1132374680 15:101321165-101321187 TTCCGCTGGCGGCCTGGGAGAGG - Intronic
1132570587 16:642295-642317 CCCCGCCGGCCGCCCTAGAGCGG + Intronic
1132692478 16:1187781-1187803 CTCCTCAGACCACCAGGGAGGGG - Intronic
1132759659 16:1502518-1502540 GGCCGCAGGCCCCCCGGGAGAGG - Intronic
1132879518 16:2155835-2155857 CGCCCGCGGCCGCCCGGGAGCGG - Exonic
1133038219 16:3046403-3046425 CGACGCAGGACGCCCGGGCGGGG - Intergenic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1137476933 16:48817367-48817389 CTCTGCAGGCTGGCTGGGAGTGG - Intergenic
1137725002 16:50651042-50651064 CTCTGCAGGAGGCCCAGGAGGGG - Intergenic
1139750550 16:69106785-69106807 CTCCCCTGGCCGGCCTGGAGGGG + Intronic
1142000532 16:87661730-87661752 CCCCGCAGGCCGCCACGGGGCGG + Intronic
1142184134 16:88686410-88686432 CCCGGCCTGCCGCCCGGGAGGGG - Exonic
1142642983 17:1295407-1295429 CTCAGCAGGCAGCCCTGGGGTGG - Intronic
1142737126 17:1908212-1908234 TTGGGGAGGCCGCCCGGGAGGGG - Intergenic
1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG + Intronic
1142860002 17:2755672-2755694 CTCCGCGGGCCGCACGGTGGAGG - Intergenic
1148674707 17:49438673-49438695 CTCCGCAGCCCGCCCGTGCCTGG + Intronic
1149461705 17:56834292-56834314 CTCCGGAGGCCTCCCGAGAGGGG + Intronic
1152546732 17:81004085-81004107 CTCCGCTCCCCACCCGGGAGTGG + Intronic
1152610655 17:81313704-81313726 CCCCGCAGGCTGCCAGCGAGAGG + Exonic
1156502361 18:37567574-37567596 CCCCGCAGCCCGCGGGGGAGCGG - Intergenic
1158565973 18:58554544-58554566 CTTGGCAGGCTGCCAGGGAGGGG - Intronic
1159952768 18:74496819-74496841 CTCAGCAGGCCCCTGGGGAGGGG - Intronic
1160266162 18:77342066-77342088 CACTGCAGGCCGCACGGGAGGGG - Intergenic
1160389805 18:78521573-78521595 CTCCGCAGGATGCGTGGGAGAGG + Intergenic
1163608346 19:18288001-18288023 CCCCGCAGGGCGGTCGGGAGTGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1167310605 19:48735495-48735517 CACCCGACGCCGCCCGGGAGCGG + Exonic
1167650927 19:50728233-50728255 CTCCGCAGAGAGCCAGGGAGAGG - Intergenic
926095605 2:10079585-10079607 CTTCCCGGGCCGCCCTGGAGCGG - Intronic
927591353 2:24360533-24360555 CTCCGCAGGAAGCCGGGGGGCGG + Exonic
929787106 2:45001016-45001038 CGCCCCAGGCCGCCCTGCAGTGG - Intergenic
929829285 2:45334410-45334432 CTCGGGAGGCCGCCAGGGCGCGG + Intergenic
930358391 2:50347534-50347556 CTCCGCGCGCTGCCCGGGGGAGG - Intronic
931762968 2:65432705-65432727 CTCCGCGGCTCCCCCGGGAGTGG - Intergenic
934616568 2:95774915-95774937 CTCTGCAGGCCGCCTGGTACAGG + Intergenic
934644324 2:96049644-96049666 CTCTGCAGGCCGCCTGGTACAGG - Intergenic
934837740 2:97605734-97605756 CTCTGCAGGCCGCCTGGTACAGG - Intergenic
935150217 2:100427256-100427278 CTCCGCAGGCAGCCCGTCTGCGG - Intergenic
935820146 2:106886399-106886421 TCCCGCAGGCCGCCTGGGACGGG - Exonic
936396591 2:112136642-112136664 CTCCACAGGCTGCCCTGGATCGG + Intergenic
938934372 2:136116282-136116304 CCCCCCACGCCGCCTGGGAGTGG - Intronic
948981628 2:241497679-241497701 CTCCGCAGGCTGCAAAGGAGTGG + Exonic
1170839184 20:19909842-19909864 CTCAGCAGGCAGCCTGGGTGTGG + Intronic
1171499913 20:25585466-25585488 CTCCGCCGTCCGCCCGCGCGGGG + Exonic
1174606715 20:51767285-51767307 CTCCACAGGCCGCGCAGGTGAGG - Intronic
1175399652 20:58693094-58693116 CTCCGCGGGCCGCCCGGGCCTGG - Intronic
1178922479 21:36747770-36747792 CCCGCCAGGCCGCCCGGGACGGG + Exonic
1179817478 21:43917066-43917088 GCCCGCAGGGTGCCCGGGAGTGG - Intronic
1180156857 21:45982169-45982191 GACCGCAGGCAGCTCGGGAGGGG + Intronic
1180620715 22:17159789-17159811 CTCCGCAGTGCGCGCGGGGGCGG - Intronic
1182059401 22:27386220-27386242 CTCAGGAGGCAGCCCAGGAGAGG + Intergenic
1182463708 22:30501110-30501132 CTCAGCATGAGGCCCGGGAGAGG + Intronic
1183295049 22:37024467-37024489 GTACGCAGGCCGCCTGGGCGTGG + Exonic
1183546288 22:38456044-38456066 CGCCGCGGGCCCCGCGGGAGGGG - Intergenic
1184032035 22:41900837-41900859 CTCTGCAGGCAGCCTTGGAGTGG + Intronic
1184036213 22:41919573-41919595 CTCCTGAGGTCGCCAGGGAGCGG + Intergenic
1184692389 22:46123186-46123208 CTCTGCAGGCGGCCCTGGTGGGG - Intergenic
1184784676 22:46665925-46665947 CTCTGCTGGCCGCCCGGGGAAGG - Intronic
1185044899 22:48523903-48523925 CACCACAGGCCGCCCAGGCGAGG + Intronic
1185281509 22:49971894-49971916 CCCCGCAGCCCGCCTGGGACCGG - Intergenic
950264747 3:11565311-11565333 CTCCCCAGGCTCCCAGGGAGTGG - Intronic
951543517 3:23805722-23805744 CTCCTCCGGACGCCCGGGAAGGG - Intergenic
951982068 3:28576331-28576353 CTCCGCCAGCCCCCTGGGAGCGG - Intergenic
954149091 3:48648356-48648378 CTCCCCAGGCAGCGCGGGACTGG - Exonic
954367439 3:50154191-50154213 CTCCGCAGGGTGCCCGGGGCAGG + Intergenic
954375977 3:50194326-50194348 CTCCTCAGGCCGCCCGGGACAGG - Intronic
956659336 3:71583081-71583103 GTCCGGTGGCCGCCCGGGCGCGG - Intronic
962403759 3:135083019-135083041 CTCCTCAGGCAGCCAGGCAGAGG + Intronic
963168173 3:142225633-142225655 CGCCGGCGGCCGCGCGGGAGGGG + Intergenic
963236868 3:142964104-142964126 CTCCGGAGGTCGCCGGGGAGGGG + Intergenic
966594201 3:181711781-181711803 CGCCGCCGGCCGCGCGGGGGAGG - Intergenic
966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG + Intronic
967594845 3:191316961-191316983 CTCCGCCGGCAGCCCCGGCGTGG - Intronic
968573202 4:1353256-1353278 CTCTGCAGGCCACCCCAGAGCGG + Exonic
968698213 4:2042728-2042750 CCCCGCAGGCCGCCCATGCGTGG + Exonic
969691255 4:8705394-8705416 CTCCCCAGGCCACCCTGGGGTGG - Intergenic
972407654 4:38762177-38762199 CTCCTAAGGCCGCCTGGGAGAGG - Intergenic
975485784 4:74933220-74933242 CACCGCAGCCCACCCGGCAGAGG + Exonic
990382995 5:55233760-55233782 CTCCGCGGCCCGCCGGGGGGAGG + Intergenic
992269935 5:75053555-75053577 CTGCGGAGGCCGCCCCGGCGGGG + Intergenic
992796107 5:80256148-80256170 CGCCGCCGGGCGCCCGGGAAGGG - Intergenic
997302051 5:132813553-132813575 CGCCGCGGGACGCGCGGGAGCGG - Intergenic
997695231 5:135856340-135856362 CTCAGAAGGCTGCCAGGGAGAGG - Intronic
1001823003 5:174724603-174724625 CTCCGCTGGCAACCCGGCAGCGG - Exonic
1002487668 5:179550702-179550724 CTCCGCAGGTCGCCTGGGCCGGG - Exonic
1002593107 5:180304626-180304648 CCCCACAGGCGGCCCGGGGGAGG + Intronic
1003212376 6:4079229-4079251 CGCCGCCGGCCGCCCAGGCGCGG + Exonic
1005459692 6:26056381-26056403 CTCCGCAGGAGGCGCGGCAGCGG + Exonic
1006093698 6:31643003-31643025 CTGGGCAGGCCCCCCAGGAGCGG + Exonic
1006155180 6:32009860-32009882 ATCCGCAGCCCACCTGGGAGAGG + Intergenic
1006161486 6:32042594-32042616 ATCCGCAGCCCACCTGGGAGAGG + Exonic
1010187147 6:73157414-73157436 CTGCACAGGCCGCCCGGGGGCGG + Intronic
1020006176 7:4784784-4784806 CGCCTCACGCCTCCCGGGAGGGG + Intronic
1020265253 7:6556264-6556286 TTCCCCAGGCCTCCTGGGAGAGG - Intergenic
1020272973 7:6607859-6607881 CCCCGCACCCCGCCCAGGAGAGG - Intronic
1020916443 7:14199504-14199526 CTCTGCAGGCGGCCTGGGACAGG + Intronic
1021558590 7:21946053-21946075 CTTCGCAGGCGGCGCGAGAGGGG + Exonic
1032151776 7:129435040-129435062 CGCCGCAGGCAGCCTGGGAGGGG - Intronic
1032780841 7:135164410-135164432 CCCCGCAGGTCCCCCGGCAGAGG + Exonic
1034306382 7:150048063-150048085 CTTCGCGAGCCGCCGGGGAGGGG - Intergenic
1034800464 7:154052579-154052601 CTTCGCGAGCCGCCGGGGAGGGG + Intronic
1037723843 8:21467155-21467177 CTCCTCAGCTGGCCCGGGAGTGG + Intergenic
1043346530 8:79303907-79303929 CTCCACCTGCAGCCCGGGAGCGG + Intergenic
1049082936 8:140457244-140457266 CGCCGCGGACGGCCCGGGAGGGG + Intronic
1049405772 8:142451266-142451288 CTCTTCAGGCTGCCGGGGAGTGG - Intronic
1049409036 8:142464276-142464298 CTCCGGCGGCCGCCCGCGCGCGG - Exonic
1049751187 8:144285006-144285028 CTCCGCAGGACGCCCCGGGCCGG + Intronic
1061726495 9:132584795-132584817 CTAAGCAGGCCCCCCGGGGGAGG - Intronic
1062398901 9:136363838-136363860 CCCCTCAGGCCGCCAGGGGGCGG - Intronic
1187900616 X:24024823-24024845 CTCCGCAGGCCGGCGGCCAGGGG + Intronic
1189534609 X:41923534-41923556 CGCCACCGCCCGCCCGGGAGTGG + Intergenic