ID: 1142814007

View in Genome Browser
Species Human (GRCh38)
Location 17:2411263-2411285
Sequence TCCTTCCCACCTCTTAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142814007_1142814016 28 Left 1142814007 17:2411263-2411285 CCTCCCTTAAGAGGTGGGAAGGA 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1142814016 17:2411314-2411336 CGACCAGTAGCTCCAGTGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1142814007_1142814017 29 Left 1142814007 17:2411263-2411285 CCTCCCTTAAGAGGTGGGAAGGA 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1142814017 17:2411315-2411337 GACCAGTAGCTCCAGTGAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 145
1142814007_1142814011 -10 Left 1142814007 17:2411263-2411285 CCTCCCTTAAGAGGTGGGAAGGA 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1142814011 17:2411276-2411298 GTGGGAAGGACCCTAAAACAGGG 0: 1
1: 0
2: 1
3: 11
4: 163
1142814007_1142814012 -3 Left 1142814007 17:2411263-2411285 CCTCCCTTAAGAGGTGGGAAGGA 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1142814012 17:2411283-2411305 GGACCCTAAAACAGGGAAACAGG 0: 1
1: 0
2: 2
3: 15
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142814007 Original CRISPR TCCTTCCCACCTCTTAAGGG AGG (reversed) Intronic
901449130 1:9325458-9325480 GCCTGCCCACCTCTTCAGGAAGG + Intronic
901562983 1:10087812-10087834 TAATTCCCACCCCTTAAGTGTGG - Intronic
903192039 1:21662381-21662403 TCCTTCCCAGCTCTGAAGCTGGG + Intronic
906480126 1:46194218-46194240 TCCTTCCCAGCTCAGCAGGGGGG - Intronic
907343562 1:53755524-53755546 ACATTCCCACCTCTTAAGGTAGG + Intergenic
907834290 1:58094177-58094199 TCTGTCCCTCCACTTAAGGGTGG + Intronic
908682099 1:66673778-66673800 TCTTTCCCACCTCATAATGAAGG + Intronic
908881859 1:68741916-68741938 TAATTCCCACATCTTATGGGAGG + Intergenic
910241476 1:85091402-85091424 TCCTTCCCACATCTCAGGGATGG - Intronic
912789211 1:112635199-112635221 TCCTTCCCATTTTTTAAGGTTGG - Intronic
915556130 1:156661765-156661787 TCCTTCCCACGTCTAAACAGGGG + Intergenic
915630387 1:157149642-157149664 TAGATCCCACCTCTTAAGGGAGG - Intergenic
920457628 1:206113218-206113240 TGCTTCCCAGCCCTTGAGGGTGG + Intronic
920825444 1:209420831-209420853 TCCAGCCCACCTCTGAAGGCAGG + Intergenic
924002374 1:239568258-239568280 TAATTCCCACCTGTTACGGGAGG + Intronic
1064550700 10:16498235-16498257 TCTTTCCCAGCTTTTAAGGTCGG - Intronic
1065103271 10:22353015-22353037 TCCTTCCCACTACATAGGGGAGG + Intronic
1067516824 10:46955488-46955510 AATTTCCCACCTCTTAAGTGTGG + Intronic
1067645427 10:48096338-48096360 AATTTCCCACCTCTTAAGTGTGG - Intergenic
1068511001 10:57965639-57965661 GGCTTCCCACCTCCTGAGGGGGG + Intergenic
1068682879 10:59838925-59838947 TGCTTCTCACCCCTTAAAGGAGG - Intronic
1070440138 10:76435120-76435142 TCCTTCCCAGTACTTAAGGAAGG + Intronic
1070617124 10:77977770-77977792 TCCTTCCCATCTAAAAAGGGTGG + Intronic
1074386145 10:113018234-113018256 CTCCTCCCACCTCTTAAGAGTGG - Intronic
1075456419 10:122587905-122587927 TCCCTCCTACCTCTGAAGTGTGG - Intronic
1078553190 11:12294282-12294304 TCCTTTCCAACTCTGAAGGCGGG + Exonic
1080788715 11:35499916-35499938 TCCTGCCTCCCTCTTACGGGGGG - Intronic
1080970593 11:37270726-37270748 TCCTTCCCATTTGTCAAGGGAGG + Intergenic
1081195841 11:40159528-40159550 TTCTTCCCACTTACTAAGGGAGG + Intronic
1081478673 11:43462587-43462609 TCCTTCACAGCTCTTAAGGCAGG - Intronic
1083846970 11:65341052-65341074 TCCTTCCCATCTATTAAGCCAGG + Exonic
1084106506 11:66984206-66984228 TCCTTGCCAGCTCTTAGGGCAGG + Intergenic
1084192086 11:67503971-67503993 CCATTCCCACATCTGAAGGGGGG + Intronic
1085392310 11:76188801-76188823 TCCTTCCCTCCTCTGCACGGCGG - Intronic
1088558302 11:111086003-111086025 TCCTTCCCACCCTTTCGGGGAGG - Intergenic
1089743714 11:120602427-120602449 TCCTTCCTTCCTCTTCAGGTGGG - Intronic
1090341445 11:126024821-126024843 TACTTCCCATCTCTAAAGGTTGG - Intronic
1090755447 11:129786061-129786083 TACTTCCCACATGTTATGGGAGG - Intergenic
1092526591 12:9313489-9313511 TCCATCTCGCCTCTTAAGGTGGG - Intergenic
1094506327 12:31064561-31064583 GCATTCCCACCTCCTAAGGATGG - Intergenic
1095781354 12:46064048-46064070 AACTTCCCACCTCTGAAGTGTGG + Intergenic
1097596774 12:61643136-61643158 TCCTTGCAACCCCTTAAGGCTGG + Intergenic
1097911375 12:64973418-64973440 TAATTCCCACCTGTCAAGGGTGG - Intergenic
1098043085 12:66371768-66371790 TCCTACCCACATCTGAAGGCAGG + Exonic
1098164040 12:67674618-67674640 TCATTCCCACCTGTTGTGGGAGG - Intergenic
1099914258 12:88872593-88872615 TAATTCCCACCTGTCAAGGGTGG + Intergenic
1100819613 12:98419106-98419128 TCCTGCCCTTCTCTTTAGGGTGG + Intergenic
1101734744 12:107454600-107454622 TCCTTGCCACCTTTTCAGGCAGG + Intronic
1105544499 13:21341877-21341899 ACCTTCCCAGGTCTTATGGGCGG - Intergenic
1105700650 13:22933410-22933432 TCCTTCCCACCTCTTGTGCCAGG + Intergenic
1105794741 13:23840008-23840030 TTCTTCCCAGCTCTTGTGGGTGG - Intronic
1105853445 13:24355565-24355587 TCCTTCCCACCTCTTGTGCCAGG + Intergenic
1107765968 13:43735004-43735026 TGCTTCCCACCTCCAAAGGCAGG + Intronic
1107860622 13:44657035-44657057 TCCTTCCCTCACCTTAGGGGTGG + Intergenic
1112824941 13:103381596-103381618 TAATTCCCACATGTTAAGGGTGG - Intergenic
1113812173 13:113149572-113149594 ACCTTCCCACCTCAACAGGGCGG - Intergenic
1115007291 14:28500396-28500418 TAATTCCCACCTGTTATGGGAGG - Intergenic
1117978763 14:61321894-61321916 TCCTTTCCACCTCGGGAGGGAGG + Exonic
1118362487 14:65068143-65068165 ACCTCCCCACTTCTTAAGCGTGG - Intronic
1119631384 14:76235289-76235311 TACTTTCCACATGTTAAGGGTGG + Intronic
1121869647 14:97395345-97395367 GACTTCCTACCTCCTAAGGGTGG - Intergenic
1125420945 15:39503471-39503493 TAATTCCCACCTGTTGAGGGAGG - Intergenic
1125686692 15:41567776-41567798 TCCTTCAGACCTTTTTAGGGGGG - Intronic
1125757216 15:42071907-42071929 TCCTTCCCACCCCATTAGAGTGG - Exonic
1126676100 15:51160381-51160403 CCCTGCCCCCCTCTGAAGGGTGG - Intergenic
1127254993 15:57282469-57282491 TTCTTCCCTTCTCTTAAGGCAGG - Exonic
1128998713 15:72316061-72316083 TGCCTCCCACCTCTGGAGGGAGG + Intronic
1129965174 15:79728686-79728708 CCTTTCCCACCACTTAATGGAGG + Intergenic
1130682233 15:86006755-86006777 TACTTACCTCCTCTTAAAGGGGG - Intergenic
1130742315 15:86613941-86613963 TCCTTTCCATCTCCTAAGGGAGG + Intronic
1137721687 16:50631245-50631267 ACCTTCCCATCCCTTTAGGGTGG + Intronic
1138567173 16:57841907-57841929 TCCTCCCCTCTTCTCAAGGGTGG + Intronic
1140048761 16:71461398-71461420 TCTTTCCTACCACTTAAGTGTGG - Intronic
1142740016 17:1926416-1926438 TCCTTCCCACCACGAAAAGGGGG - Intergenic
1142814007 17:2411263-2411285 TCCTTCCCACCTCTTAAGGGAGG - Intronic
1144705192 17:17363514-17363536 TCGTTGCCACCTCCTAAGGAAGG + Intergenic
1147721380 17:42541682-42541704 TCCTTCCTGCCACTTAAAGGAGG + Intronic
1148778432 17:50108740-50108762 CCCCTCCCACCTCCTGAGGGAGG + Intronic
1148791369 17:50175149-50175171 TCCTCCCCACCACTTATGTGGGG - Intronic
1149203839 17:54220016-54220038 GCCTCCTCACCTCTAAAGGGAGG - Intergenic
1150470339 17:65431899-65431921 TAATTCCCACCTGTTATGGGAGG + Intergenic
1150587170 17:66529496-66529518 TCCTTCCCATCACTTGTGGGTGG + Intronic
1151509945 17:74552138-74552160 CCGTTCCCACCTCTGCAGGGAGG - Intergenic
1151558347 17:74858535-74858557 TCCCTCCTACCTCTGTAGGGTGG - Intronic
1152137358 17:78512379-78512401 CCCTTCCCACCGCTTGAAGGTGG + Intronic
1153057764 18:964575-964597 TCCTTTTCACCTCTTCAGGACGG + Intergenic
1156860092 18:41826178-41826200 TCCTACCCACCTGTTTAGAGAGG + Intergenic
1158343054 18:56487221-56487243 TCCATCCCACCTCTTTGTGGTGG - Intergenic
1159718929 18:71860328-71860350 TGATTCCCACATGTTAAGGGTGG - Intergenic
1161632681 19:5366676-5366698 TCCACCCCTCCTCTCAAGGGAGG + Intergenic
1164583906 19:29453517-29453539 TCCTTCCCACCTCCTCAGTGAGG - Intergenic
1166302552 19:41920823-41920845 GCCTCCCCACCTCTCAAGCGAGG - Intronic
1167048357 19:47064890-47064912 CCCTTCCCTCCTCCTCAGGGTGG - Exonic
1167506848 19:49875503-49875525 TCCTTCCCAGCTGATGAGGGAGG + Intronic
1168372647 19:55849102-55849124 AACTCCCCACCTCTTAAGTGTGG - Intronic
926478800 2:13360618-13360640 TCATCCCCACGTGTTAAGGGTGG - Intergenic
927948338 2:27150600-27150622 TCTTTCCCTCCTCTTCAAGGAGG - Intronic
929704555 2:44196563-44196585 AACTTCCCACCCCATAAGGGTGG - Intronic
935740176 2:106140498-106140520 TCCACCCCTCCTCTTTAGGGTGG + Intronic
935848545 2:107193777-107193799 TCCTTTCCACCCCTTCAGGCTGG + Intergenic
936079204 2:109420868-109420890 TCCTGCCCACCACTTAAGAAAGG - Intronic
941856900 2:170240478-170240500 TGCTTCCCTCCTTTTCAGGGAGG + Intronic
942496868 2:176549184-176549206 TCCTTCCTATCTCTTCATGGGGG + Intergenic
943700206 2:190981022-190981044 TCCCTCCCTCCTCTAAAGAGAGG + Intronic
943917845 2:193660642-193660664 TAATTCCCACCTGTCAAGGGTGG + Intergenic
945175732 2:207041477-207041499 TCCATCCCTCCTCCTAAGGAGGG - Intergenic
948217610 2:236243478-236243500 TCCTTCACACATCCTCAGGGTGG - Intronic
1168978066 20:1982828-1982850 TCCATCCCACCTGTGCAGGGTGG - Intronic
1172766402 20:37353461-37353483 TTCCTCCCACTTCTGAAGGGAGG + Intronic
1172963338 20:38814334-38814356 GCCTTCCCCCCTCTGAAGGAAGG - Intronic
1173892626 20:46524952-46524974 TACTCCCCACCTCTTAATGTAGG + Intergenic
1175139834 20:56852724-56852746 TAGTTCCTACCTCTTAACGGTGG - Intergenic
1180650932 22:17376304-17376326 GCCTTCTCATCTCTGAAGGGCGG + Intronic
1182061859 22:27404187-27404209 ACCTTCCTACCTCTCAGGGGTGG + Intergenic
1182842252 22:33400863-33400885 TCCTTCTCACCTCATAAATGAGG - Intronic
1182921505 22:34084221-34084243 TCCTTCCTACCTCATAAAGATGG - Intergenic
1183420666 22:37709655-37709677 TCCTCCCCACCTCTGGAGAGCGG - Intronic
1183832451 22:40425533-40425555 TCCTTCCCAGGTCCTGAGGGAGG - Intronic
1184766120 22:46573434-46573456 TCCTTCCCACCTCTCCTCGGTGG + Intergenic
950256126 3:11507775-11507797 TCCTTCCCACATCTAGAGTGTGG - Intronic
951574678 3:24101493-24101515 TGCTTCCAAGCTCTTGAGGGAGG + Intergenic
953106335 3:39884223-39884245 TCCCTCTCATTTCTTAAGGGTGG - Intronic
956077088 3:65517027-65517049 CCCATCCCACCTCTTTAAGGGGG + Intronic
956650321 3:71498924-71498946 TCCTTCCTAGATCTTCAGGGTGG - Intronic
956742506 3:72286353-72286375 TCCTTCCATCCTGTTAAGGCTGG + Intergenic
959063386 3:101635254-101635276 TCCTTTTCACCTCTGAAGAGAGG + Intergenic
961108970 3:124267662-124267684 TCCTTCCTTCCTCTTAGGAGAGG + Intronic
963446835 3:145422160-145422182 AGCATCCCACCTCTTAAGTGAGG + Intergenic
966984572 3:185167468-185167490 TCCTTCCTACCTCCTCAGTGAGG - Intergenic
969326552 4:6447580-6447602 TCCTTCCCCCTGCTTTAGGGGGG + Intronic
971156212 4:24085928-24085950 TCCTTACCACCTCTGAATGAGGG - Intergenic
982211825 4:153043484-153043506 TCCATCCCACCTCTTCAGCAAGG - Intergenic
982340903 4:154297626-154297648 TCCTTCTGACCTCTAAAGGAGGG - Intronic
983523135 4:168731705-168731727 TCCTTGCCACTTCTTGAAGGTGG - Intronic
986144741 5:5066659-5066681 TTTTTCCCCCCTCTTGAGGGCGG - Intergenic
988259411 5:28864834-28864856 GCCTTCCCACCTTCTAAAGGTGG + Intergenic
988866827 5:35344194-35344216 TACTTCCCACCTGTTGTGGGAGG - Intergenic
990249122 5:53894755-53894777 TCCTTCCCACCTGTGGATGGAGG - Intronic
992921314 5:81524771-81524793 TGCTTCCCTCCTCTTAACTGTGG - Intronic
992993484 5:82309341-82309363 TCCTTCTCACCTCCCAAGAGAGG - Intronic
993522109 5:88915590-88915612 TCTTTCCAAGCTCTGAAGGGTGG + Intergenic
993933863 5:93976490-93976512 TAATCCCCACCTCTCAAGGGAGG + Intronic
994182806 5:96785939-96785961 TCCATTCCACCTCTTCTGGGAGG + Exonic
994544290 5:101143619-101143641 TAATTCCCACCTGTTGAGGGAGG + Intergenic
994548849 5:101205807-101205829 TCATTCCCACCTGTTGTGGGAGG + Intergenic
996071331 5:119135572-119135594 TACTTCCCACGTGTTGAGGGAGG + Intronic
997760101 5:136437984-136438006 ACATTCCCACCTCTTAAGTGTGG - Intergenic
998081442 5:139278347-139278369 TCCTTCACCCATCTGAAGGGAGG + Exonic
999956313 5:156706494-156706516 TGTTTCCCACCACCTAAGGGTGG - Intronic
1001794269 5:174489047-174489069 TCCTTCCTACCACTGCAGGGTGG - Intergenic
1002060731 5:176624285-176624307 TCCTGACCACCTTATAAGGGAGG + Intronic
1002637226 5:180614426-180614448 TCCCTCCCAGCTCTCAGGGGAGG + Intronic
1003407132 6:5834676-5834698 ACCTTCCCAGGTCTTAAGGGTGG + Intergenic
1006077961 6:31546440-31546462 TCTTTCCAAACTCCTAAGGGAGG + Intronic
1006878891 6:37321952-37321974 TCCTCCCAACCTTTTGAGGGTGG - Intronic
1007422966 6:41730552-41730574 TCCTTCCTGGCTCTTAAGTGTGG - Intronic
1009490389 6:64283936-64283958 TCATTCCCACCTATTGTGGGAGG - Intronic
1010712244 6:79188784-79188806 TCTTTTCCATCTCTAAAGGGAGG - Intergenic
1011717971 6:90126971-90126993 TCCTTCCTCCCTTTAAAGGGGGG + Intronic
1012867315 6:104633637-104633659 TAATTCCCACCTGTTATGGGAGG - Intergenic
1012968364 6:105700166-105700188 TCATACCCAACTCTTAAGTGTGG + Intergenic
1013423100 6:109984028-109984050 TCCGTCCCACCTCTTGATGGAGG + Intergenic
1013542173 6:111121928-111121950 TCCTTCCCACCTCCCCAGGATGG + Intronic
1014213923 6:118735213-118735235 TCCTTCCCTCCACTTAAAGCAGG - Intergenic
1016103219 6:140128660-140128682 CCCTTCTCCCCTCTGAAGGGTGG + Intergenic
1017468474 6:154716957-154716979 TCCTCCCCTCCCCTTCAGGGAGG + Intergenic
1019170228 6:170129594-170129616 TCCATCCCACCTGTCAAGTGTGG + Intergenic
1020404475 7:7816497-7816519 TCATTCCCACCTCTGAGTGGCGG - Intronic
1020838500 7:13184819-13184841 TAATCCCCACCTGTTAAGGGAGG + Intergenic
1023842104 7:44103800-44103822 TCCTACCAACCTCTTCAGGTCGG - Intergenic
1026093724 7:67323727-67323749 TCTTTCCAAGCTCTGAAGGGTGG - Intergenic
1027771357 7:82410585-82410607 TCCCTCACACCTGTCAAGGGAGG + Intronic
1030075104 7:105730036-105730058 CCCTCCCCACTTCTTAAGTGTGG + Intronic
1034414945 7:150959431-150959453 CACTTCCCACCTCCAAAGGGGGG + Intronic
1038717901 8:30008389-30008411 TCCTTCCTAACTCTAAAGGATGG - Intergenic
1041756857 8:61323390-61323412 TCCATTCCACCTCTTGAGGGAGG + Intronic
1042161969 8:65905546-65905568 TAATTCCCACATGTTAAGGGAGG + Intergenic
1044730593 8:95225826-95225848 TCCCTCCCACCCCTGCAGGGAGG + Intergenic
1048496313 8:134939036-134939058 TCCTTGCTCCCTCTTTAGGGAGG + Intergenic
1050572120 9:6950973-6950995 TCTTTGCCATCTCTGAAGGGAGG + Intronic
1053330982 9:37206777-37206799 TCCTGGCCACCTTGTAAGGGAGG - Intronic
1053419852 9:37970424-37970446 TCCTTCCCATCTCATCAGGCTGG - Intronic
1055428281 9:76217960-76217982 TCCTTCCCACCTCATTGAGGTGG - Intronic
1056370037 9:85944622-85944644 TCCTTCCCAGATCTTATGGGTGG + Intronic
1056683743 9:88742578-88742600 CCCTGCCCACATCTGAAGGGTGG + Intergenic
1058647691 9:107145839-107145861 TCCTTCCCACCTGTAAAATGGGG + Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1185719906 X:2373235-2373257 TGATTCCCACCTGTGAAGGGTGG - Intronic
1186079936 X:5920079-5920101 TCATTTCCACCTCTTCAGAGAGG - Intronic
1186098919 X:6134054-6134076 TGCTTCCCATCTCTAAAAGGAGG + Intronic
1186275620 X:7935139-7935161 TAATTCCCACCTGTTGAGGGAGG - Intergenic
1188504476 X:30866796-30866818 AACCTCCCACCTCTTAAGTGTGG + Intronic
1188913930 X:35887241-35887263 TCCTTTTCACCTCTCAAGTGTGG + Intergenic
1189722070 X:43930312-43930334 GCCATCCCACCTCTTCAGGAAGG - Intergenic
1190137387 X:47809103-47809125 TAATTCCCACCTGTCAAGGGAGG - Intergenic
1191673224 X:63768639-63768661 TAATTCCCACATGTTAAGGGAGG + Intronic
1194969868 X:100331619-100331641 TAATCCCCACCTGTTAAGGGAGG + Intronic
1195424622 X:104714344-104714366 TAATTCCCACCTGTCAAGGGTGG + Intronic
1196929757 X:120669756-120669778 TACTTCCCACATGTCAAGGGTGG + Intergenic
1202188034 Y:22208613-22208635 TCTTTCTCACCTCTTAAGCTAGG + Intergenic
1202203326 Y:22377783-22377805 TCTTTCTCACCTCTTAAGCTAGG - Intronic