ID: 1142815518

View in Genome Browser
Species Human (GRCh38)
Location 17:2422007-2422029
Sequence GGTGCCATTGGTTTTTAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142815518_1142815528 23 Left 1142815518 17:2422007-2422029 CCACTTTAAAAACCAATGGCACC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1142815528 17:2422053-2422075 TGTAATCCTAGCACTCTGGGAGG 0: 658
1: 31076
2: 324240
3: 254433
4: 137894
1142815518_1142815527 20 Left 1142815518 17:2422007-2422029 CCACTTTAAAAACCAATGGCACC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1142815527 17:2422050-2422072 GCTTGTAATCCTAGCACTCTGGG 0: 14
1: 1432
2: 32520
3: 264038
4: 274153
1142815518_1142815526 19 Left 1142815518 17:2422007-2422029 CCACTTTAAAAACCAATGGCACC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1142815526 17:2422049-2422071 TGCTTGTAATCCTAGCACTCTGG 0: 7
1: 788
2: 16259
3: 126592
4: 255579
1142815518_1142815523 -8 Left 1142815518 17:2422007-2422029 CCACTTTAAAAACCAATGGCACC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1142815523 17:2422022-2422044 ATGGCACCTGCCGGGCGCGGTGG 0: 1
1: 3
2: 13
3: 151
4: 1096

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142815518 Original CRISPR GGTGCCATTGGTTTTTAAAG TGG (reversed) Intronic
904773143 1:32892260-32892282 AGTGCCAATGGCTTTTAAATAGG + Intronic
910072422 1:83233376-83233398 TGTGCCATTGGCTTTTGAACGGG - Intergenic
911115834 1:94246594-94246616 GCCACCCTTGGTTTTTAAAGAGG + Intronic
911530562 1:99038486-99038508 GGTGGCATTGGTATTTCAAAAGG + Intergenic
912720329 1:112014626-112014648 GGTTCCATTGGCTTTTACACTGG + Intergenic
915014677 1:152721604-152721626 GTTTGCATTGGGTTTTAAAGAGG - Intergenic
915817890 1:158989513-158989535 GGTGTCCTTGTTTTTTAAAAAGG + Intergenic
917888920 1:179417750-179417772 AATGCCATTGGTATTTTAAGAGG + Intronic
919134514 1:193490936-193490958 TGTCCCATTGTTTTCTAAAGTGG + Intergenic
919948888 1:202344024-202344046 GGTGTCATTGTTTTTAAAAATGG + Intergenic
921939542 1:220826073-220826095 TGTGCAATGGGTGTTTAAAGAGG + Intergenic
922408068 1:225339413-225339435 GATCCCATGGCTTTTTAAAGTGG + Intronic
923484393 1:234415150-234415172 GGTCCCATTGGCTTTTCAACAGG - Intronic
1063665202 10:8056471-8056493 AGTGCCTTTGGTTTTTAGACAGG + Intronic
1068338236 10:55666366-55666388 GGGGACATTTATTTTTAAAGAGG - Intergenic
1070578497 10:77699383-77699405 AGTGCCAATGTTTTTCAAAGTGG - Intergenic
1071815406 10:89227495-89227517 GGTGCCTCTGGTTTTAAAAATGG + Intronic
1072326068 10:94300082-94300104 GGTGCCATTGGTTATTATCCCGG + Intronic
1080951001 11:37032871-37032893 GGTGTCATTGTCTTTTGAAGGGG - Intergenic
1081698463 11:45136210-45136232 AGTTCCATTGGATTTTGAAGGGG + Intronic
1084462713 11:69304869-69304891 GGTCCCTTTGATGTTTAAAGAGG - Intronic
1097761099 12:63465289-63465311 AATGCCATTGGTTGTTAAATAGG + Intergenic
1105652113 13:22390326-22390348 GGTGCCATTGGGTATTAGAAGGG - Intergenic
1105970474 13:25425072-25425094 GCTACTAGTGGTTTTTAAAGAGG + Intronic
1107027977 13:35823055-35823077 GATGCCACTGGTTTTTGTAGTGG - Intronic
1108246463 13:48519489-48519511 GGTACCATAGGTTTTTATACAGG - Intronic
1110488616 13:76075684-76075706 GGTTCCATTTCTTTTTAAGGGGG - Intergenic
1112976687 13:105328474-105328496 TGTACCTTTGGTTTTTAATGAGG - Intergenic
1113696857 13:112353112-112353134 GGTGCCATTGGTTTTCGATGGGG + Intergenic
1115926565 14:38442275-38442297 GGTGGCTTTGGTTTTTATTGTGG + Intergenic
1117052602 14:51876669-51876691 GGGGCCATATGTTTTTAAATGGG - Intronic
1118443695 14:65833578-65833600 GGTGCCACTTGTTTTTAAAAAGG + Intergenic
1121122144 14:91382870-91382892 TGTGACACTGGTTGTTAAAGAGG - Intronic
1123797590 15:23787927-23787949 GGGGCCAAGGTTTTTTAAAGTGG + Intergenic
1124420101 15:29513655-29513677 GCTGCCTTTTGTTTTCAAAGTGG - Intronic
1125335951 15:38626464-38626486 AGTGCCATAGGTTTTTAATATGG - Intergenic
1125350673 15:38763839-38763861 AATGCCATTCCTTTTTAAAGAGG - Intergenic
1127618811 15:60713335-60713357 GGCGCCATTGGTTTTCTTAGTGG - Intronic
1129314424 15:74732615-74732637 GGTGATATTGGTTTTTTAACAGG - Intergenic
1131674301 15:94655326-94655348 GGGGCCATTTGTTTTAAAAGTGG + Intergenic
1131782618 15:95876005-95876027 GATTCCATTGGTTTTTAAACTGG - Intergenic
1137702831 16:50509549-50509571 GGTTTCATTTGTTTTTAAAAAGG + Intergenic
1140300028 16:73748602-73748624 GGAGTGATTGGTTTTGAAAGAGG - Intergenic
1140618886 16:76702899-76702921 GGGACCATTGGTTTTGAAGGAGG - Intergenic
1142815518 17:2422007-2422029 GGTGCCATTGGTTTTTAAAGTGG - Intronic
1142963864 17:3568507-3568529 GGTTCCATTGGTTTTTCCACAGG - Intronic
1143791351 17:9298506-9298528 GGTTTTTTTGGTTTTTAAAGTGG - Intronic
1148257264 17:46146275-46146297 GTTTCCTGTGGTTTTTAAAGAGG - Intronic
1149970167 17:61209988-61210010 GCTGCCACTGCTTCTTAAAGAGG + Intronic
1150554101 17:66238091-66238113 GATGCCATTGGTTTGGAGAGTGG - Intronic
1154065098 18:11100457-11100479 GGTGCCCTTGGTATTTACTGTGG - Intronic
1155051497 18:22151797-22151819 TGTACAATTGGTTCTTAAAGGGG - Intergenic
1155722264 18:29030476-29030498 TGTGCTATTGGTGTTTAAACTGG + Intergenic
1158065034 18:53396490-53396512 GATTACATTGGTGTTTAAAGTGG - Intronic
1161875667 19:6907128-6907150 AGTGACATTGATTTCTAAAGAGG - Intronic
1162414787 19:10528965-10528987 GGTGCCATTGCTTTAGAAAATGG - Intergenic
1163399199 19:17081860-17081882 GGTCCCATGGGATTTTACAGGGG + Intronic
1164694976 19:30236664-30236686 GGTGGCAGTAGTTATTAAAGGGG - Intronic
1168044192 19:53782295-53782317 GGTGGCATTTTTTTTTAAACTGG - Intergenic
927080864 2:19629487-19629509 ATTTCCATTGGATTTTAAAGAGG - Intergenic
927711314 2:25328085-25328107 GGTGTCATAGGTTTTCATAGAGG - Intronic
928631479 2:33197574-33197596 GGTGTCCTTTGTTTTTAAATTGG + Intronic
929688937 2:44058787-44058809 GGTGCCATGTGCATTTAAAGTGG - Intergenic
930799066 2:55423563-55423585 GGTGCCATTCTTTTTTACAAAGG - Intergenic
931787572 2:65633998-65634020 AATGCCATATGTTTTTAAAGAGG - Intergenic
932696627 2:73962257-73962279 GGCACCGTGGGTTTTTAAAGTGG + Intergenic
933261850 2:80140198-80140220 GGTGCATTTGGTTTTCAAATTGG - Intronic
935142311 2:100364198-100364220 GGAGCAATTGTTTTTTAAATAGG + Intergenic
935545329 2:104394923-104394945 GGTGCCATTTGCTCTTACAGAGG + Intergenic
935803863 2:106727655-106727677 GGTGCTATGGGATTTTAGAGGGG + Intergenic
939459702 2:142484007-142484029 GTTGCCTTTGATTTTTAAACTGG - Intergenic
941485393 2:166073891-166073913 TGTGCCATGAGTTTTAAAAGTGG + Intronic
941834919 2:170005488-170005510 GTTGCCATGAGTTTTTGAAGTGG + Intronic
942221128 2:173770141-173770163 CTTGCGATTGGTATTTAAAGTGG - Intergenic
942287150 2:174430780-174430802 GATCCCTTTGGTATTTAAAGAGG - Intergenic
948990927 2:241553617-241553639 GGTGCCACACGCTTTTAAAGAGG + Intergenic
1170467200 20:16632870-16632892 GGTGCCTTTGGTTTTTTGACTGG + Intergenic
1170665615 20:18383557-18383579 GCTACCATTTGTTTTAAAAGAGG + Exonic
1170803338 20:19608803-19608825 GGGGGCCTAGGTTTTTAAAGCGG - Intronic
1177907231 21:26986754-26986776 GTTGCCATTGGTTTTTTAACTGG + Intergenic
1178674290 21:34617590-34617612 GGTGCCAGTGTTTCTGAAAGGGG + Intergenic
1181897184 22:26120598-26120620 GGTGCCATTTGTTCTTCATGAGG + Intergenic
1182301235 22:29338307-29338329 GGTGCCATTTGTTTCTGAAGTGG - Intronic
1182818570 22:33191503-33191525 AATGTCATTGGTTTTCAAAGGGG + Intronic
1183030403 22:35099702-35099724 GGGGCCATTCGTCTTTAAGGTGG - Intergenic
950733121 3:14980010-14980032 GGTGGCAATGGTTTTAAAATAGG - Intronic
951247079 3:20353597-20353619 GGTGGAAGTGGCTTTTAAAGAGG + Intergenic
955417202 3:58703496-58703518 AGTGCCTTTGGTTTTTATTGTGG + Intergenic
955829018 3:62981715-62981737 AGTGCCTTAAGTTTTTAAAGAGG + Intergenic
957524725 3:81365226-81365248 GGTGGCTATGATTTTTAAAGGGG + Intergenic
960623368 3:119657385-119657407 GGTGCAATTGTTTTTTTAATTGG - Intronic
961491539 3:127259743-127259765 GGAGGCACTGGTCTTTAAAGTGG + Intergenic
966283880 3:178270017-178270039 GGGGCCATTCACTTTTAAAGGGG - Intergenic
967875007 3:194262543-194262565 GGAGCCATTGATTATTATAGAGG + Intergenic
969111050 4:4844505-4844527 GGAGCCAGTGGTTTTCAGAGCGG + Intergenic
972146122 4:36027933-36027955 GGTCCCATTGGTTCCTGAAGAGG - Intronic
974836220 4:67254122-67254144 GGTTCCATAGAATTTTAAAGTGG + Intergenic
975118800 4:70705990-70706012 TGTGCCAGTGGCTTTAAAAGTGG - Intronic
976327967 4:83794475-83794497 GGTGCCTTTGATTTTACAAGTGG - Intergenic
977268998 4:94891531-94891553 GGTACTAGTGGTTTTTGAAGTGG + Intronic
978553882 4:109957949-109957971 GGTGCTATTGTTTTTAAAATGGG + Intronic
985281894 4:188295318-188295340 GGTGACATGGGTATATAAAGAGG - Intergenic
985941929 5:3143162-3143184 GGTGGAATTGGTGTTAAAAGTGG - Intergenic
986262672 5:6162051-6162073 GGTCCCATTGGCCTTTAGAGTGG + Intergenic
991966934 5:72101918-72101940 GGAGCCATTTGTGTTTTAAGTGG + Intergenic
992215592 5:74521905-74521927 GCTGACATTTGTTTTTACAGTGG - Intergenic
992496716 5:77300974-77300996 AGTGAGATTGGTTTTTAAATGGG + Intronic
994589589 5:101757017-101757039 AATGGCATTAGTTTTTAAAGTGG - Intergenic
997261076 5:132465883-132465905 GCTGACAGTGGTTTTTAAAGGGG + Intronic
997986639 5:138506874-138506896 GGTGCATTTGGTTTTCAAATTGG - Exonic
998881545 5:146650407-146650429 GGTGCCAGTGTATTTTAAAAGGG + Intronic
998975455 5:147641208-147641230 TATACCATTGGTTTTTAATGTGG - Intronic
1003870102 6:10395584-10395606 GCGGCAATTGTTTTTTAAAGCGG - Intronic
1012610120 6:101207419-101207441 GGTGCCTTTTGTTTATAAACTGG - Intergenic
1012980511 6:105825254-105825276 GGTGACATTGTTTCTTAAACTGG - Intergenic
1021592486 7:22279037-22279059 GGTTTCAGTGGTTTGTAAAGAGG - Intronic
1023372996 7:39530575-39530597 GGGGCCATGGGTGCTTAAAGGGG - Intergenic
1023512182 7:40965062-40965084 TGTGCCCTTGGTTTCTAAGGAGG + Intergenic
1027290135 7:76698349-76698371 TGTGCCATTGGCTTTTGAACGGG - Intergenic
1031529838 7:122863137-122863159 GGTGACATTGTTTTTCAAAATGG + Intronic
1031801172 7:126248016-126248038 AGTGCCATTGGTATTTTAATAGG + Intergenic
1032921573 7:136554821-136554843 TGTTCCATTGATTTTTAGAGTGG - Intergenic
1035983911 8:4403942-4403964 GATGCCAAAGGTTTTGAAAGAGG - Intronic
1036492622 8:9242005-9242027 TGTGATATTGGTTTTTAAAATGG + Intergenic
1038462813 8:27730788-27730810 GCTGCCTTTGATTTTTAAAAAGG + Intergenic
1039285902 8:36040768-36040790 GGTTCCAGTGGTTCTTAAGGAGG - Intergenic
1043126528 8:76403543-76403565 TGTGCCACTCATTTTTAAAGTGG + Intergenic
1043629625 8:82313250-82313272 GGTGCCCTTCGATATTAAAGAGG - Intergenic
1043927564 8:86054724-86054746 GGTGCCATTTAATTTTAAAATGG + Intronic
1044005975 8:86937407-86937429 GGTACAATTGGTTTTGAAATGGG - Intronic
1046504251 8:115116772-115116794 GGTGTCTCTGGTTTTCAAAGTGG + Intergenic
1047360065 8:124160938-124160960 GATGCCATTTGTTTTTATGGGGG + Intergenic
1050019616 9:1269554-1269576 GGTGCCCTGGGCCTTTAAAGTGG + Intergenic
1051145338 9:14021395-14021417 GCTGCCATTTGTTTATAAAAGGG + Intergenic
1051392766 9:16583886-16583908 GGTGAGATGGTTTTTTAAAGTGG - Intronic
1052028519 9:23601996-23602018 GCTGCCAGTGGTTGTTCAAGGGG + Intergenic
1052213369 9:25934287-25934309 GATGCCATCTGATTTTAAAGTGG - Intergenic
1058942753 9:109829255-109829277 GTTGCCATGGGGTTTTATAGGGG - Intronic
1186858737 X:13650334-13650356 GCTGCCAGTGGATTCTAAAGAGG - Intergenic
1187525254 X:20048280-20048302 AGTGCCAACGGTTTTTACAGAGG - Intronic
1187964548 X:24597555-24597577 GGTGCCTTTCTTTTGTAAAGTGG - Intronic
1189177328 X:38971208-38971230 GGGGCCACTGGTTTTAAAATGGG + Intergenic
1191876021 X:65797228-65797250 GGTGCATTTGGTTTTCAAATTGG + Intergenic
1194637116 X:96359711-96359733 TGTGTCATTGGTTTGTATAGAGG - Intergenic
1198129054 X:133675759-133675781 GTTGCCACTGGTTTCTAAAATGG - Intronic
1201857691 Y:18563562-18563584 GGTGCCCATGTGTTTTAAAGAGG - Intronic
1201875630 Y:18756819-18756841 GGTGCCCATGTGTTTTAAAGAGG + Intronic
1202256720 Y:22928954-22928976 GGTGCTATTGGGTTGGAAAGAGG - Intergenic
1202409711 Y:24562707-24562729 GGTGCTATTGGGTTGGAAAGAGG - Intergenic
1202461072 Y:25107370-25107392 GGTGCTATTGGGTTGGAAAGAGG + Intergenic