ID: 1142815521

View in Genome Browser
Species Human (GRCh38)
Location 17:2422019-2422041
Sequence CCGCGCCCGGCAGGTGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142815521_1142815528 11 Left 1142815521 17:2422019-2422041 CCAATGGCACCTGCCGGGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1142815528 17:2422053-2422075 TGTAATCCTAGCACTCTGGGAGG 0: 658
1: 31076
2: 324240
3: 254433
4: 137894
1142815521_1142815526 7 Left 1142815521 17:2422019-2422041 CCAATGGCACCTGCCGGGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1142815526 17:2422049-2422071 TGCTTGTAATCCTAGCACTCTGG 0: 7
1: 788
2: 16259
3: 126592
4: 255579
1142815521_1142815530 21 Left 1142815521 17:2422019-2422041 CCAATGGCACCTGCCGGGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1142815530 17:2422063-2422085 GCACTCTGGGAGGCCGAAGCAGG 0: 92
1: 5169
2: 101945
3: 237440
4: 235241
1142815521_1142815527 8 Left 1142815521 17:2422019-2422041 CCAATGGCACCTGCCGGGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1142815527 17:2422050-2422072 GCTTGTAATCCTAGCACTCTGGG 0: 14
1: 1432
2: 32520
3: 264038
4: 274153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142815521 Original CRISPR CCGCGCCCGGCAGGTGCCAT TGG (reversed) Intronic
900819266 1:4873649-4873671 CTGTGCACGGCAGGTGGCATTGG - Intergenic
901071711 1:6523287-6523309 CCGCACCCGGCTGGTGGCAGTGG - Exonic
901271288 1:7953982-7954004 CTGGGCCCAGCAGGTGCCAAGGG + Intergenic
901526405 1:9825483-9825505 CCGGGCCAGGCAGGTGCTTTGGG - Intergenic
905182271 1:36174846-36174868 CCGGGCCCGGCAGGAGCCAGTGG - Intronic
912337591 1:108877078-108877100 CCGCCCCCGGCAGGTCACGTGGG - Exonic
915313439 1:155015832-155015854 AAGGGCCCGGCAGGGGCCATGGG + Intronic
916651717 1:166839757-166839779 CGCCGCCCGGCAGGTGCGCTGGG + Intronic
919902848 1:202056922-202056944 CCCCACCCCGCAGGTGGCATGGG - Intergenic
919928944 1:202208803-202208825 CCACCCCCAGCAGGTGCCCTGGG - Intronic
1065574436 10:27103779-27103801 CCACGCCCGGCACTGGCCATGGG - Intergenic
1072611100 10:97018247-97018269 CTGCTCCTGCCAGGTGCCATGGG - Intronic
1074586013 10:114768257-114768279 CCGCGCCCGGCGGGTCCCTGCGG - Intergenic
1077091102 11:778627-778649 CCGCGCCCGGCGGAGGCCAGTGG - Intronic
1077372751 11:2191176-2191198 TCCCGCCAGGCAGGTGCCCTGGG - Intergenic
1083655460 11:64227066-64227088 CCGCTCCCGGCAGGTGGCTGAGG + Exonic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1084018491 11:66402172-66402194 CCGCGCCTGGCCGATTCCATGGG + Intergenic
1103897043 12:124279761-124279783 CAGCTCCCCGCAGGTGCCATGGG - Intronic
1104448924 12:128853792-128853814 GCGCGCCCGGCAGGCGGCACCGG - Intronic
1104927326 12:132320726-132320748 CCGCCCCCACCAGGTGCCCTCGG + Intronic
1105278374 13:18949148-18949170 CAGGGCCCGGGAGGTGGCATTGG - Intergenic
1108027875 13:46197405-46197427 CCGGTCCCAGTAGGTGCCATTGG + Intronic
1113665052 13:112135780-112135802 CCGTCCCCGGCAGGGGCCCTAGG - Intergenic
1119260990 14:73237931-73237953 CCCCTCCCGGGAGGTGCCACTGG + Intronic
1126635643 15:50777339-50777361 CCGTGCCTGGCTGGTGTCATGGG - Intergenic
1129891460 15:79074544-79074566 CCACACCTGGAAGGTGCCATGGG + Intronic
1130894221 15:88157998-88158020 CCGGGCCCGTGAGGTGCCAAAGG - Intronic
1134763532 16:16735149-16735171 CTGGGCCCGGCCGGTGACATTGG + Intergenic
1134982520 16:18624008-18624030 CTGGGCCCGGCCGGTGACATTGG - Intergenic
1136220181 16:28823440-28823462 CCGCTCCCGGCAGCGGCCACAGG - Exonic
1137403990 16:48175907-48175929 TGGAGCCTGGCAGGTGCCATGGG - Intronic
1139956730 16:70696849-70696871 CCCAGCCCGGCAGGTGCCAGCGG - Intronic
1142319886 16:89374523-89374545 CAGCGGCCGGCAGAGGCCATCGG - Intronic
1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG + Intergenic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG + Intergenic
1150288161 17:63965775-63965797 CCGCGCCCGGCAGGCAGCATTGG + Intronic
1152718114 17:81909546-81909568 CTGCGCCAGGCACGGGCCATGGG - Exonic
1157584170 18:48790753-48790775 CCCCGCCCGGCTGGAGCCACGGG + Intronic
1162123639 19:8487460-8487482 CACAGCCCAGCAGGTGCCATGGG + Intronic
1163366426 19:16878378-16878400 CCGGGCCAAGCAGGTGCCAGGGG + Exonic
1163535433 19:17873883-17873905 CCGCGCCCGTCAGGCGCAAGTGG + Intronic
1163899156 19:20085548-20085570 CCGCGCCCGGCCAGTTGCATTGG + Intronic
1165040472 19:33064706-33064728 CCGGGCCCTGCAGGGGCCGTGGG - Intronic
1165419960 19:35717818-35717840 CCGCGGCCGGCCGGCGCCCTCGG - Intergenic
1166725107 19:45022159-45022181 CCGCACCCTGCAGATGCCGTCGG - Exonic
1166960355 19:46493156-46493178 CTGCGCCTGGCAGGTGCTGTAGG - Exonic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
938583864 2:132670472-132670494 CCGCACCCGGCAGGTCCCCACGG - Intronic
939218394 2:139270706-139270728 CCTCACTTGGCAGGTGCCATTGG + Intergenic
940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG + Intergenic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
947863989 2:233383329-233383351 CCGCGCCCAGCCCGTTCCATGGG + Intronic
947908012 2:233779831-233779853 CCGCTGCCTGCAGGTGCCAGAGG + Exonic
1169344947 20:4822629-4822651 CCGAGCGAGGCAGGTGCCGTGGG - Intronic
1171481333 20:25458015-25458037 TTGGGCCCGGCAGGTGCCGTGGG - Intronic
1171767914 20:29300424-29300446 CCGCGCCCGCCACGTGCTAGTGG - Intergenic
1173672993 20:44810685-44810707 CCGGGCCCGGCAGGTGCGCGCGG + Intergenic
1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG + Intronic
1179150859 21:38806637-38806659 CCGCGCCCCGCAGGTTCCCGCGG - Intronic
1179731974 21:43373117-43373139 CGGCGACCGGGACGTGCCATTGG - Intergenic
1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG + Intronic
1180843759 22:18970802-18970824 CCGCGCCAGGCTGGGGCCAAGGG + Intergenic
1183069744 22:35387776-35387798 CCACCCCCTGGAGGTGCCATGGG + Intronic
1185082469 22:48717665-48717687 TCGGGCACTGCAGGTGCCATTGG + Intronic
949928030 3:9057548-9057570 CCCCTCCCAGCAGGTGCCACGGG + Intronic
950670822 3:14524379-14524401 CCCCGCCCGGTGGGTGCCCTTGG - Exonic
968899413 4:3423986-3424008 CCGGGCCCAGCAGGTGCAGTGGG - Intronic
970709298 4:18843084-18843106 CCACGAATGGCAGGTGCCATAGG - Intergenic
974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG + Intergenic
982357945 4:154490329-154490351 CCGCGCCCGGCAAGTGCCTGGGG - Intronic
1007122679 6:39396413-39396435 CCGAGCCCAGCAGGTGCACTGGG + Intronic
1022459388 7:30590566-30590588 CCGCGCCCGGCCGATTCCTTAGG - Intergenic
1035687745 8:1538066-1538088 CCGAGCCCTGCAGGTGCCCCAGG - Intronic
1038575665 8:28701699-28701721 CCGCGCCCGGAAGGGCTCATGGG + Intronic
1041823797 8:62068616-62068638 CCACTCCCGGCAGCTGTCATGGG - Intergenic
1053269421 9:36739956-36739978 CGTGGCCCCGCAGGTGCCATGGG - Intergenic
1057783798 9:98071929-98071951 CCGTGCCCTGCAGGTGGCATCGG + Intronic
1060210201 9:121705764-121705786 CCAGGCCTGACAGGTGCCATGGG + Intronic
1061808609 9:133149661-133149683 CCGAGTCCAGCAGGTGGCATCGG - Intergenic
1062722547 9:138051929-138051951 CCTTGCCCTGCAGGTGCCACAGG - Intronic