ID: 1142815524

View in Genome Browser
Species Human (GRCh38)
Location 17:2422028-2422050
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19558
Summary {0: 186, 1: 1736, 2: 3930, 3: 6575, 4: 7131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142815524_1142815530 12 Left 1142815524 17:2422028-2422050 CCTGCCGGGCGCGGTGGCTCATG 0: 186
1: 1736
2: 3930
3: 6575
4: 7131
Right 1142815530 17:2422063-2422085 GCACTCTGGGAGGCCGAAGCAGG 0: 92
1: 5169
2: 101945
3: 237440
4: 235241
1142815524_1142815526 -2 Left 1142815524 17:2422028-2422050 CCTGCCGGGCGCGGTGGCTCATG 0: 186
1: 1736
2: 3930
3: 6575
4: 7131
Right 1142815526 17:2422049-2422071 TGCTTGTAATCCTAGCACTCTGG 0: 7
1: 788
2: 16259
3: 126592
4: 255579
1142815524_1142815532 26 Left 1142815524 17:2422028-2422050 CCTGCCGGGCGCGGTGGCTCATG 0: 186
1: 1736
2: 3930
3: 6575
4: 7131
Right 1142815532 17:2422077-2422099 CGAAGCAGGCAGATCACTTGAGG 0: 112
1: 2592
2: 14151
3: 38129
4: 73631
1142815524_1142815527 -1 Left 1142815524 17:2422028-2422050 CCTGCCGGGCGCGGTGGCTCATG 0: 186
1: 1736
2: 3930
3: 6575
4: 7131
Right 1142815527 17:2422050-2422072 GCTTGTAATCCTAGCACTCTGGG 0: 14
1: 1432
2: 32520
3: 264038
4: 274153
1142815524_1142815528 2 Left 1142815524 17:2422028-2422050 CCTGCCGGGCGCGGTGGCTCATG 0: 186
1: 1736
2: 3930
3: 6575
4: 7131
Right 1142815528 17:2422053-2422075 TGTAATCCTAGCACTCTGGGAGG 0: 658
1: 31076
2: 324240
3: 254433
4: 137894

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142815524 Original CRISPR CATGAGCCACCGCGCCCGGC AGG (reversed) Intronic