ID: 1142815525

View in Genome Browser
Species Human (GRCh38)
Location 17:2422032-2422054
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363125
Summary {0: 236, 1: 9036, 2: 60409, 3: 126173, 4: 167271}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142815525_1142815527 -5 Left 1142815525 17:2422032-2422054 CCGGGCGCGGTGGCTCATGCTTG 0: 236
1: 9036
2: 60409
3: 126173
4: 167271
Right 1142815527 17:2422050-2422072 GCTTGTAATCCTAGCACTCTGGG 0: 14
1: 1432
2: 32520
3: 264038
4: 274153
1142815525_1142815526 -6 Left 1142815525 17:2422032-2422054 CCGGGCGCGGTGGCTCATGCTTG 0: 236
1: 9036
2: 60409
3: 126173
4: 167271
Right 1142815526 17:2422049-2422071 TGCTTGTAATCCTAGCACTCTGG 0: 7
1: 788
2: 16259
3: 126592
4: 255579
1142815525_1142815532 22 Left 1142815525 17:2422032-2422054 CCGGGCGCGGTGGCTCATGCTTG 0: 236
1: 9036
2: 60409
3: 126173
4: 167271
Right 1142815532 17:2422077-2422099 CGAAGCAGGCAGATCACTTGAGG 0: 112
1: 2592
2: 14151
3: 38129
4: 73631
1142815525_1142815528 -2 Left 1142815525 17:2422032-2422054 CCGGGCGCGGTGGCTCATGCTTG 0: 236
1: 9036
2: 60409
3: 126173
4: 167271
Right 1142815528 17:2422053-2422075 TGTAATCCTAGCACTCTGGGAGG 0: 658
1: 31076
2: 324240
3: 254433
4: 137894
1142815525_1142815533 27 Left 1142815525 17:2422032-2422054 CCGGGCGCGGTGGCTCATGCTTG 0: 236
1: 9036
2: 60409
3: 126173
4: 167271
Right 1142815533 17:2422082-2422104 CAGGCAGATCACTTGAGGTCAGG 0: 5109
1: 22033
2: 51527
3: 94535
4: 120222
1142815525_1142815530 8 Left 1142815525 17:2422032-2422054 CCGGGCGCGGTGGCTCATGCTTG 0: 236
1: 9036
2: 60409
3: 126173
4: 167271
Right 1142815530 17:2422063-2422085 GCACTCTGGGAGGCCGAAGCAGG 0: 92
1: 5169
2: 101945
3: 237440
4: 235241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142815525 Original CRISPR CAAGCATGAGCCACCGCGCC CGG (reversed) Intronic