ID: 1142815526

View in Genome Browser
Species Human (GRCh38)
Location 17:2422049-2422071
Sequence TGCTTGTAATCCTAGCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399225
Summary {0: 7, 1: 788, 2: 16259, 3: 126592, 4: 255579}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142815525_1142815526 -6 Left 1142815525 17:2422032-2422054 CCGGGCGCGGTGGCTCATGCTTG 0: 236
1: 9036
2: 60409
3: 126173
4: 167271
Right 1142815526 17:2422049-2422071 TGCTTGTAATCCTAGCACTCTGG 0: 7
1: 788
2: 16259
3: 126592
4: 255579
1142815521_1142815526 7 Left 1142815521 17:2422019-2422041 CCAATGGCACCTGCCGGGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1142815526 17:2422049-2422071 TGCTTGTAATCCTAGCACTCTGG 0: 7
1: 788
2: 16259
3: 126592
4: 255579
1142815518_1142815526 19 Left 1142815518 17:2422007-2422029 CCACTTTAAAAACCAATGGCACC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1142815526 17:2422049-2422071 TGCTTGTAATCCTAGCACTCTGG 0: 7
1: 788
2: 16259
3: 126592
4: 255579
1142815524_1142815526 -2 Left 1142815524 17:2422028-2422050 CCTGCCGGGCGCGGTGGCTCATG 0: 186
1: 1736
2: 3930
3: 6575
4: 7131
Right 1142815526 17:2422049-2422071 TGCTTGTAATCCTAGCACTCTGG 0: 7
1: 788
2: 16259
3: 126592
4: 255579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142815526 Original CRISPR TGCTTGTAATCCTAGCACTC TGG Intronic
Too many off-targets to display for this crispr