ID: 1142815532

View in Genome Browser
Species Human (GRCh38)
Location 17:2422077-2422099
Sequence CGAAGCAGGCAGATCACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128615
Summary {0: 112, 1: 2592, 2: 14151, 3: 38129, 4: 73631}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142815529_1142815532 -5 Left 1142815529 17:2422059-2422081 CCTAGCACTCTGGGAGGCCGAAG 0: 138
1: 8099
2: 145450
3: 286825
4: 202641
Right 1142815532 17:2422077-2422099 CGAAGCAGGCAGATCACTTGAGG 0: 112
1: 2592
2: 14151
3: 38129
4: 73631
1142815524_1142815532 26 Left 1142815524 17:2422028-2422050 CCTGCCGGGCGCGGTGGCTCATG 0: 186
1: 1736
2: 3930
3: 6575
4: 7131
Right 1142815532 17:2422077-2422099 CGAAGCAGGCAGATCACTTGAGG 0: 112
1: 2592
2: 14151
3: 38129
4: 73631
1142815525_1142815532 22 Left 1142815525 17:2422032-2422054 CCGGGCGCGGTGGCTCATGCTTG 0: 236
1: 9036
2: 60409
3: 126173
4: 167271
Right 1142815532 17:2422077-2422099 CGAAGCAGGCAGATCACTTGAGG 0: 112
1: 2592
2: 14151
3: 38129
4: 73631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142815532 Original CRISPR CGAAGCAGGCAGATCACTTG AGG Intronic
Too many off-targets to display for this crispr