ID: 1142815533

View in Genome Browser
Species Human (GRCh38)
Location 17:2422082-2422104
Sequence CAGGCAGATCACTTGAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293426
Summary {0: 5109, 1: 22033, 2: 51527, 3: 94535, 4: 120222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142815529_1142815533 0 Left 1142815529 17:2422059-2422081 CCTAGCACTCTGGGAGGCCGAAG 0: 138
1: 8099
2: 145450
3: 286825
4: 202641
Right 1142815533 17:2422082-2422104 CAGGCAGATCACTTGAGGTCAGG 0: 5109
1: 22033
2: 51527
3: 94535
4: 120222
1142815525_1142815533 27 Left 1142815525 17:2422032-2422054 CCGGGCGCGGTGGCTCATGCTTG 0: 236
1: 9036
2: 60409
3: 126173
4: 167271
Right 1142815533 17:2422082-2422104 CAGGCAGATCACTTGAGGTCAGG 0: 5109
1: 22033
2: 51527
3: 94535
4: 120222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142815533 Original CRISPR CAGGCAGATCACTTGAGGTC AGG Intronic
Too many off-targets to display for this crispr