ID: 1142829973

View in Genome Browser
Species Human (GRCh38)
Location 17:2541546-2541568
Sequence TACCCCAGCCTGAGACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142829973_1142829979 18 Left 1142829973 17:2541546-2541568 CCTGTCTGTCTCAGGCTGGGGTA No data
Right 1142829979 17:2541587-2541609 GCATTGAGGGAATGTGTGAGTGG No data
1142829973_1142829983 30 Left 1142829973 17:2541546-2541568 CCTGTCTGTCTCAGGCTGGGGTA No data
Right 1142829983 17:2541599-2541621 TGTGTGAGTGGGAGGCAGGAAGG No data
1142829973_1142829981 22 Left 1142829973 17:2541546-2541568 CCTGTCTGTCTCAGGCTGGGGTA No data
Right 1142829981 17:2541591-2541613 TGAGGGAATGTGTGAGTGGGAGG No data
1142829973_1142829980 19 Left 1142829973 17:2541546-2541568 CCTGTCTGTCTCAGGCTGGGGTA No data
Right 1142829980 17:2541588-2541610 CATTGAGGGAATGTGTGAGTGGG No data
1142829973_1142829976 -7 Left 1142829973 17:2541546-2541568 CCTGTCTGTCTCAGGCTGGGGTA No data
Right 1142829976 17:2541562-2541584 TGGGGTAGAAGAAGGTAGGAAGG No data
1142829973_1142829977 4 Left 1142829973 17:2541546-2541568 CCTGTCTGTCTCAGGCTGGGGTA No data
Right 1142829977 17:2541573-2541595 AAGGTAGGAAGGCAGCATTGAGG No data
1142829973_1142829982 26 Left 1142829973 17:2541546-2541568 CCTGTCTGTCTCAGGCTGGGGTA No data
Right 1142829982 17:2541595-2541617 GGAATGTGTGAGTGGGAGGCAGG No data
1142829973_1142829978 5 Left 1142829973 17:2541546-2541568 CCTGTCTGTCTCAGGCTGGGGTA No data
Right 1142829978 17:2541574-2541596 AGGTAGGAAGGCAGCATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142829973 Original CRISPR TACCCCAGCCTGAGACAGAC AGG (reversed) Intergenic
No off target data available for this crispr