ID: 1142837555

View in Genome Browser
Species Human (GRCh38)
Location 17:2599373-2599395
Sequence TGTTAAATGGTGAAAGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142837551_1142837555 11 Left 1142837551 17:2599339-2599361 CCTTCTTTCTATAACGATTGGAC 0: 1
1: 0
2: 0
3: 5
4: 208
Right 1142837555 17:2599373-2599395 TGTTAAATGGTGAAAGTTGGTGG 0: 1
1: 0
2: 0
3: 29
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142837555 Original CRISPR TGTTAAATGGTGAAAGTTGG TGG Intronic
901127071 1:6937110-6937132 TGGTAAATGGTGAATGGTGATGG - Intronic
904446745 1:30579538-30579560 TGTTTGTTGTTGAAAGTTGGTGG + Intergenic
904680947 1:32228800-32228822 TCTTACATGGTCATAGTTGGGGG - Exonic
904867330 1:33590818-33590840 TGTTAACTCGTGAACGGTGGGGG + Intronic
906790965 1:48658575-48658597 TGTGAAATGGGCAGAGTTGGGGG - Intronic
907099655 1:51817984-51818006 TGCTAAATGGTTTAAGTTTGGGG - Intronic
907486162 1:54779749-54779771 TGAAGAATGGTGAAAGTTTGTGG + Exonic
907583848 1:55597024-55597046 TTGTATATGGTGAAAGATGGGGG + Intergenic
908753871 1:67449847-67449869 TTTTAAAAATTGAAAGTTGGTGG - Intergenic
908769759 1:67585237-67585259 TGTTAACTGGTGAACCTTGGAGG + Intergenic
910181793 1:84492343-84492365 TGCTGAATGGTGAAAGTTAAAGG + Intronic
910972012 1:92865516-92865538 TGTTAACTTATGAAAGTTGTAGG - Intronic
911258367 1:95658676-95658698 GGTGAAATGGTGACAATTGGAGG + Intergenic
912322276 1:108725258-108725280 TGTAAAATGATGATAGTTGCTGG + Intronic
913142100 1:115951702-115951724 TGTTAAGGGGTGGAAGTTGGAGG - Intergenic
913313423 1:117528104-117528126 TGTTAAATAGTGGAAGTTTAAGG - Exonic
917619629 1:176782860-176782882 AGTTAAGAGGTGAGAGTTGGTGG + Intronic
918930269 1:190846515-190846537 TTGTAAATGGTGAAAGGTAGGGG - Intergenic
919049230 1:192492706-192492728 TGTCAAATTGTGAAACATGGGGG + Intergenic
920591883 1:207227837-207227859 TGTTAAATGGAGACAGTGTGGGG - Intergenic
921440279 1:215177527-215177549 TTGTATATGGTGAAAGTTAGGGG + Intronic
921682720 1:218053307-218053329 TGGGAAGTGGGGAAAGTTGGGGG + Intergenic
921811084 1:219515381-219515403 GGCTACATGATGAAAGTTGGGGG + Intergenic
922671839 1:227514931-227514953 TGTAAACTTGTGAATGTTGGGGG - Intergenic
922911348 1:229220451-229220473 TGGTAAATGGTGGAGGATGGTGG - Intergenic
923285930 1:232495261-232495283 TTTTAAAAGATGAAAGGTGGGGG + Intronic
924198780 1:241639451-241639473 GATTAACTCGTGAAAGTTGGAGG - Intronic
1063127307 10:3147149-3147171 TGTTAAATGGTGATAATATGAGG - Exonic
1063959472 10:11295046-11295068 TGTAAAATGTTGAAACTTGCAGG - Intronic
1064468033 10:15605012-15605034 TGATAAATTATGAAATTTGGGGG + Intronic
1064500338 10:15964733-15964755 TGTTTCATGGTGAAAGTTTATGG + Intergenic
1065522929 10:26589441-26589463 TTTTAAATTGTGAAAATTGAGGG - Intergenic
1068139804 10:52991759-52991781 TGGTTAATAGTGAATGTTGGTGG + Intergenic
1068265235 10:54639834-54639856 TGTTAAATAGTGATAGTTTCAGG - Intronic
1069068320 10:63969221-63969243 TTTTATATGGTGAAAGGTAGGGG - Intergenic
1069105340 10:64376668-64376690 TGATAAATGGGGATGGTTGGTGG + Intergenic
1071828553 10:89349718-89349740 TGTTGAAAGCTGTAAGTTGGAGG - Intronic
1072657706 10:97341929-97341951 TGTTAAATGCTGAAATTCTGAGG + Intergenic
1075988760 10:126814481-126814503 TTATATATGGTGAGAGTTGGGGG + Intergenic
1076920345 10:133449429-133449451 TTTTATATGGTGAAAGATAGAGG - Intergenic
1078247408 11:9587278-9587300 TGTTATACGGTGAAAGCTTGGGG + Intronic
1079421140 11:20289927-20289949 TGTTAAAAGGAGAAAGCTTGTGG - Intergenic
1079703686 11:23585755-23585777 TTTTATATGGTGAAAGCTGCAGG + Intergenic
1079703792 11:23587545-23587567 TTTTATATGGTGAAAGCTGCAGG - Intergenic
1081338177 11:41894095-41894117 TGTTAAATGTTGATAGTTGTAGG + Intergenic
1082655111 11:55845152-55845174 TTGTAAATGGTGACAGTTAGTGG + Intergenic
1085301013 11:75458283-75458305 TGTTAAGATGTGAAAATTGGGGG + Intronic
1085827392 11:79862463-79862485 TGTTAAATGCTGTCAGTGGGGGG - Intergenic
1085935306 11:81134604-81134626 TGTGATTTGTTGAAAGTTGGAGG + Intergenic
1086808476 11:91273507-91273529 TGTTACATGGAGAAAGAGGGAGG - Intergenic
1087478987 11:98675505-98675527 TTTTATATGGTGAAAGGTAGGGG + Intergenic
1088144401 11:106657953-106657975 TGTTAAATCCTGAAATGTGGAGG + Intergenic
1088712447 11:112520792-112520814 AGTTAAATGCTAAAAATTGGAGG - Intergenic
1089380314 11:118025965-118025987 TTGTATATGGTGAAAGTTAGGGG + Intergenic
1089896615 11:121936402-121936424 TGTTAAATTGTGAATGTTACTGG + Intergenic
1090590946 11:128267315-128267337 TGCTAAATGATGATATTTGGTGG - Intergenic
1092315239 12:7405422-7405444 TTTTGAATGGTGAAAGTGGTTGG + Intronic
1093092845 12:14940517-14940539 TTTTATATGGTGAAAGATGAGGG - Intergenic
1093810127 12:23482394-23482416 TTTTATATGGTGAAAGGTAGGGG - Intergenic
1093877939 12:24372100-24372122 TTTTAAAAGGTGAAAGTAAGTGG + Intergenic
1095966020 12:47867630-47867652 AGTTAGATGGGGAAAGATGGTGG + Intronic
1096318475 12:50589937-50589959 TTTTAACTGGTGAAAGTAAGGGG + Intronic
1096663797 12:53148731-53148753 TGTTAAGTGGAGGAACTTGGAGG - Intergenic
1096906421 12:54941000-54941022 TGTTAAATTTTAAAAGTAGGAGG - Intergenic
1097320052 12:58215455-58215477 TTGTAAATGGTGAAAGATAGGGG + Intergenic
1097908833 12:64947832-64947854 TTTTAAATGGTCAAAGTTGTAGG + Intergenic
1098061723 12:66570064-66570086 TGTTAAAATGTGTATGTTGGGGG + Intronic
1098067668 12:66636570-66636592 TGTGAAATGGTCAAGGTAGGGGG - Intronic
1098563296 12:71902280-71902302 TGCAAAATGAAGAAAGTTGGAGG + Intronic
1098997395 12:77136547-77136569 TGTTAAATGTTGATTGTAGGAGG + Intergenic
1099271680 12:80518649-80518671 TTGTATATGGTGAAAGATGGAGG + Intronic
1101318457 12:103651266-103651288 TGTTAGATGGTAAAGGTGGGAGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1105828927 13:24146874-24146896 TGTAAAATGTTCAAAATTGGTGG - Intronic
1108289542 13:48945050-48945072 TCTTAAATGGAGAAAATTGGAGG - Intergenic
1109016304 13:57019753-57019775 TTTTAAAAAGTGAGAGTTGGGGG - Intergenic
1109606188 13:64700582-64700604 TTTTAAATTCTGAAAGTTTGGGG + Intergenic
1109780927 13:67108420-67108442 TGTTAAATTGTGACAGTTAATGG + Intronic
1109880373 13:68465909-68465931 TTTTATATGGTGAAAGTTAAGGG + Intergenic
1110965820 13:81695686-81695708 CATTAAATGGTTAAAGTTAGAGG + Intergenic
1111419362 13:87991004-87991026 TGTTAAATTGTCAATGTTTGAGG - Intergenic
1112395938 13:99031919-99031941 TGTTCATTTGTGGAAGTTGGAGG - Intronic
1112890902 13:104230093-104230115 TGTTAAAAGGTGGAAGTTGTTGG + Intergenic
1112891085 13:104232299-104232321 TTGTATATGGTGAAAGTTAGGGG + Intergenic
1114757042 14:25270929-25270951 TCTCACATGGTGAAAGGTGGAGG + Intergenic
1114932851 14:27495403-27495425 TGATACATGGTGAAAGTTAGAGG - Intergenic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1116018923 14:39438422-39438444 TTTTATATGGTGAAAGGTAGGGG + Intergenic
1116071693 14:40054899-40054921 TTTTAAATGTTGAAAGTTTAGGG + Intergenic
1116325465 14:43528372-43528394 TGTCAAATGGTAAAAGTTAATGG - Intergenic
1116462032 14:45188403-45188425 TGTTAAATGCTGAAAATTATAGG + Intronic
1117770420 14:59128492-59128514 TGTGAAATGGTTAAAGTTGTGGG - Intergenic
1118401210 14:65381139-65381161 TGTTAAATGGTCCAAGTTAACGG - Intergenic
1119026987 14:71161209-71161231 TTGTAAATGGTGAGAGATGGGGG - Intergenic
1120424785 14:84333310-84333332 TGTTACATGGTGAGAGCGGGAGG + Intergenic
1122078161 14:99248717-99248739 TGAAAAATGAGGAAAGTTGGGGG + Intronic
1125244507 15:37619415-37619437 TTGTACATGGTGAAAGTTAGGGG + Intergenic
1125378957 15:39066315-39066337 TGTTAAAAGATCAAAATTGGGGG + Intergenic
1126583323 15:50260580-50260602 TCTTACATGGTGAAAATTGGAGG - Intronic
1127646845 15:60967340-60967362 TGTTAATTGGTAATATTTGGGGG - Intronic
1127765321 15:62180301-62180323 TTGTATATGGTGAAAGATGGGGG - Intergenic
1128336990 15:66793249-66793271 TGTCACATGGTGAAAGCAGGAGG - Intergenic
1130782391 15:87055860-87055882 TTTTATATGGTGAAAGGTAGAGG - Intergenic
1130992074 15:88881573-88881595 TGTCAAATGGTGGAAGCTGTCGG - Exonic
1131750786 15:95505936-95505958 TGTTCAGTGGTAAAAGTTGTGGG + Intergenic
1132039800 15:98515603-98515625 TGGTATCTGGTGAAAGTTTGGGG - Intergenic
1135815634 16:25630142-25630164 TTTTATATGGTGAAAGGTAGGGG + Intergenic
1136590079 16:31213395-31213417 TTTTATATGGTGAAAGGTAGGGG + Intergenic
1138157021 16:54715285-54715307 TCATGAATGATGAAAGTTGGTGG - Intergenic
1139624834 16:68178845-68178867 TGTTAAATGGTGGCAGTTACTGG + Intronic
1139910344 16:70393755-70393777 TGGGAAATGGTGCAAGTGGGAGG - Intronic
1140870550 16:79102328-79102350 TGTTAAATGGGCAAACTGGGAGG + Intronic
1141211411 16:81983871-81983893 TTTTATATGGTGAAAGATAGGGG - Intergenic
1141356905 16:83355448-83355470 TGCTAAATGTTGGAAGTTGAAGG - Intronic
1142837555 17:2599373-2599395 TGTTAAATGGTGAAAGTTGGTGG + Intronic
1150026317 17:61678230-61678252 TGTGAAATGATGAAATTTTGGGG + Intergenic
1150859767 17:68789523-68789545 TTTTATATGGTGAGAGATGGGGG + Intergenic
1150885049 17:69075416-69075438 TTGTATATGGTGAAAGGTGGGGG + Intergenic
1151028274 17:70704900-70704922 TGTTACATGGTGGGAGCTGGAGG + Intergenic
1151089091 17:71414685-71414707 TGTCACATGGTGAAAGCAGGAGG + Intergenic
1151184986 17:72357335-72357357 TGGAAAATGGTGAACTTTGGTGG - Intergenic
1153648505 18:7217446-7217468 TTTTATATGGTGAGAGATGGGGG + Intergenic
1154503684 18:15010574-15010596 TCATACATGGTGAAAGTTAGAGG - Intergenic
1157387252 18:47268052-47268074 TGTTACTTTGTGAGAGTTGGAGG + Intergenic
1157657500 18:49405417-49405439 TTTTATATGGTGAAAGGTAGTGG + Intronic
1158088021 18:53676715-53676737 TTTTTAATGGTGAAAGGTAGGGG + Intergenic
1158393831 18:57064371-57064393 TGGAAAATGGGGAAAGTTGGGGG + Intergenic
1161328984 19:3677625-3677647 TGTTAAGTGTTGACAGGTGGGGG + Intronic
1161627897 19:5337771-5337793 TGTTCCATGGTGGAAATTGGGGG + Intronic
1165154147 19:33777310-33777332 TGGGCAAAGGTGAAAGTTGGGGG + Intergenic
1166352165 19:42204448-42204470 TGTCACATGGTGAGAGTTGGGGG - Intronic
1166429300 19:42710670-42710692 TGTCAAATCCTGAAAGTAGGGGG + Intronic
925916368 2:8609512-8609534 GCTTAAATGGTGACAATTGGAGG - Intergenic
926418060 2:12670250-12670272 TGCTAAATGTTGAATGTTGCTGG + Intergenic
928042531 2:27892158-27892180 TGTTGAATGTTGGAAGCTGGAGG - Intronic
928999997 2:37338049-37338071 TGATAAATGGTTAAATTTGTAGG + Intergenic
929920875 2:46170725-46170747 TGTTGAATGGTGAGAGAAGGTGG + Intronic
930228226 2:48816435-48816457 TGTCAGAGGGTGAAAGTGGGAGG - Intergenic
930361454 2:50385163-50385185 TTTTAAAATGGGAAAGTTGGGGG - Intronic
931743582 2:65271930-65271952 TGTATAATGGTCAAAGTTTGTGG - Intergenic
932097916 2:68868237-68868259 TGTGAAAAGGTGAAAATTGCAGG - Intronic
932395135 2:71439473-71439495 TTTTATATGGGGAAAGTTGGGGG + Intergenic
933862487 2:86483799-86483821 AGATGAATGGTGAAGGTTGGAGG + Intronic
935519487 2:104086209-104086231 TGTTAGTTGCTGAAAGCTGGGGG - Intergenic
936134922 2:109882875-109882897 TTTTATATGGTAAAAGATGGTGG + Intergenic
936209775 2:110488610-110488632 TTTTATATGGTAAAAGATGGTGG - Intergenic
936428965 2:112443860-112443882 TTTTATATGGTAAAAGATGGTGG - Intergenic
936654671 2:114471000-114471022 TGTTAAATAGTCAAGTTTGGAGG + Intronic
936917799 2:117657819-117657841 TTTTAAATGTTGAAAGTAGTAGG - Intergenic
937542305 2:122972124-122972146 TTTTAGATGGTGAGAGTTGATGG - Intergenic
937623324 2:124015252-124015274 TGTTAAATGATTAGAGATGGAGG - Intergenic
938502860 2:131840728-131840750 TCATACATGGTGAAAGTTAGAGG - Intergenic
938591300 2:132738787-132738809 TGTTACATGGTGAGAGAGGGGGG + Intronic
939250761 2:139679293-139679315 TCTAAAGTGGTGATAGTTGGGGG + Intergenic
939311968 2:140491826-140491848 TGTGATATGGTGGATGTTGGTGG + Intronic
939938062 2:148316031-148316053 TGTTACATGGTCAGAGTAGGAGG + Intronic
941413722 2:165192702-165192724 TTTTAAGAGGTGACAGTTGGTGG - Intronic
943436950 2:187876664-187876686 TGTCAAAAGCTGAAAGGTGGTGG + Intergenic
943742732 2:191427848-191427870 TTTGAAATGGTGTAAGTTGCTGG + Intergenic
944092597 2:195929691-195929713 TTGTATATGATGAAAGTTGGGGG - Intronic
944505276 2:200404541-200404563 TTTTAAAAGGTAATAGTTGGTGG + Intronic
946658758 2:221977134-221977156 TGCTAAATGGTGAAAGTACTAGG - Intergenic
946714530 2:222539345-222539367 TGTTAAATGCTGTATGTTAGAGG + Intronic
947129024 2:226902742-226902764 TGGAAAATGCTGAATGTTGGAGG + Intronic
947238786 2:227972028-227972050 TGTTAATTGGCATAAGTTGGAGG - Intergenic
947438622 2:230096348-230096370 TTATAAATGGTGAAAGGTAGGGG + Intergenic
947524990 2:230872269-230872291 GATTAAATGGTGAACATTGGAGG + Intronic
1169564677 20:6841145-6841167 TGATATATGGGGAAAGTTGGAGG - Intergenic
1170373530 20:15675573-15675595 TGAAAAATTGTGAATGTTGGAGG + Intronic
1173269389 20:41518441-41518463 TGTTAAATGTTGAAAGGAGGGGG + Intronic
1173319823 20:41977344-41977366 TGCTAAAGGCTGAAATTTGGAGG - Intergenic
1174187684 20:48718298-48718320 GGTAAAATGGTGAGAGATGGTGG + Intronic
1174808337 20:53624315-53624337 TGTAAAATGTTAAAACTTGGAGG + Intergenic
1182872424 22:33660117-33660139 TGCTAAGTTTTGAAAGTTGGAGG + Intronic
1184617951 22:45650777-45650799 TGTTTGATGGTGACAGTGGGTGG + Intergenic
1184957375 22:47899557-47899579 TGTTAAACGGTGATATATGGTGG - Intergenic
949188612 3:1223878-1223900 TGTTAAAAGGATAAAGTTGCGGG - Intronic
949226047 3:1697620-1697642 TGTGGAATGGTGCAAGTTAGGGG - Intergenic
949735826 3:7170544-7170566 TGTCATATGGTGAAATTTGGTGG + Intronic
950064252 3:10098862-10098884 TGTTAATTGTTCTAAGTTGGTGG + Exonic
950371591 3:12535400-12535422 TGTAAAATGGTTAAACTAGGAGG + Intronic
951977259 3:28526460-28526482 AGTTAAAAAGTGAAAGGTGGGGG + Intronic
952324730 3:32310781-32310803 TGTGAATTGTAGAAAGTTGGAGG + Intronic
952342410 3:32457245-32457267 TGAGAAATGGTGTCAGTTGGCGG + Intronic
952494526 3:33904244-33904266 TGTTGAATGTTGAAATTTGTTGG - Intergenic
952796141 3:37241222-37241244 TGCAAAATTGTGAAAATTGGGGG + Intergenic
956359747 3:68435098-68435120 TGTTAAATGATGGAAGCAGGAGG + Intronic
956764016 3:72468719-72468741 TGTTAAAAGCAGAAAGCTGGGGG + Intergenic
956774274 3:72551878-72551900 TGGTACATGCTGATAGTTGGGGG - Intergenic
958582210 3:96041295-96041317 AGTCAAATGGTAATAGTTGGTGG - Intergenic
958747889 3:98159539-98159561 TTTTAGATGGTGAAAGTTAAGGG - Intergenic
958905858 3:99941541-99941563 TGTTCAATGGTGAAAAGTGAGGG + Intronic
960886136 3:122397059-122397081 TTTTAAAGTGTGAAATTTGGTGG - Intronic
962046201 3:131761726-131761748 TGTTGAATGGTAAAAGTTCTAGG - Intronic
962116501 3:132514849-132514871 TGTCAAAAGTTGAAAGTTGGGGG + Intronic
962193993 3:133341850-133341872 TGTAATATGGTGAAAGATGGGGG - Intronic
962228561 3:133638777-133638799 TGTTAAATGTTGAAAAAAGGTGG - Intronic
962242844 3:133765916-133765938 TGTTAATTTATGAAAGTTTGTGG + Intronic
962876176 3:139537817-139537839 TGGTAAATGGTGGGAGGTGGTGG + Intronic
964193070 3:154028691-154028713 TGTTAAATTCTGAAAGTTCAGGG - Intergenic
964292266 3:155194638-155194660 AGTTAAATGTTTAAAGTTGTTGG + Intergenic
965306614 3:167071949-167071971 TTTTAAAATGAGAAAGTTGGAGG - Intergenic
969276476 4:6139202-6139224 TTTTAAATAGTGAAAGTTTCTGG - Intronic
970530027 4:16971991-16972013 CGATAAATGGGGAAAGTGGGGGG + Intergenic
971478191 4:27091415-27091437 TGTTAAATTGTAAAAAGTGGGGG - Intergenic
971526223 4:27621826-27621848 TTGTATATGGTGAAAGGTGGGGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972760929 4:42103050-42103072 TGTTATATGGTGAAAGATAGGGG + Intergenic
973959742 4:56097758-56097780 TGTTAGATGGAGAGAGTGGGAGG + Intergenic
974562886 4:63544484-63544506 TTATATATGGTGAAAGTTGGGGG - Intergenic
974633370 4:64525890-64525912 TGTTTATTGCTGAAAGTTGGGGG + Intergenic
975161199 4:71126136-71126158 TCTTAAATTGTGAAATTTTGGGG + Intergenic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
977321025 4:95516533-95516555 TGGTGTATGGTGAAAGCTGGGGG + Intronic
977360578 4:95999297-95999319 TGTAACATGGTGGTAGTTGGAGG - Intergenic
977642300 4:99370783-99370805 TGTTAAATTGTGAAAGTGTCTGG - Intergenic
977654168 4:99503057-99503079 TGATAAAAGGAGAAAGATGGGGG - Intergenic
978542191 4:109829916-109829938 TGTTAAAGGAGGAAAGTTAGGGG - Intronic
978630818 4:110742174-110742196 TGTTAAATGGTAAAGTTAGGAGG + Intergenic
979288252 4:118951005-118951027 TCCTAAATGGTGAAACTTGTTGG + Intronic
979469093 4:121073052-121073074 TGTTAAATCCAGAAGGTTGGTGG + Intergenic
979827796 4:125260902-125260924 CCTTGACTGGTGAAAGTTGGTGG - Intergenic
980304084 4:131034034-131034056 TTTCAAATGTTGAAAGTTGATGG - Intergenic
980432553 4:132722993-132723015 TTTTATATGGTTAAAGTTTGGGG + Intergenic
981523508 4:145689835-145689857 TTTTATATGGTGAAAGGTAGGGG - Intronic
982428709 4:155297718-155297740 TCTTACATGGTGAGAGTAGGAGG + Intergenic
982964913 4:161894040-161894062 TATAAAATGATCAAAGTTGGGGG + Intronic
983018847 4:162649054-162649076 TTTTATATGGTGAGAGATGGGGG + Intergenic
983395632 4:167191875-167191897 TATTAAATGGTGAAAACTGAAGG - Intronic
984222329 4:176993647-176993669 GCTGAAATGGAGAAAGTTGGGGG - Intergenic
986859784 5:11913154-11913176 TGTCAGTTGGTGATAGTTGGTGG + Intergenic
986997288 5:13621658-13621680 TTTTAAATTGTGAAAATTTGAGG - Intergenic
987883383 5:23779612-23779634 TGTTAAATGTTGAAAGTGGTTGG + Intergenic
989105712 5:37861431-37861453 TGTTGAAAGGGAAAAGTTGGAGG - Intergenic
990644616 5:57830155-57830177 GGATACATGGTGAAAGTTGATGG + Intergenic
990879481 5:60523389-60523411 TGTTAGCCGGTGAAAGTTGGAGG - Intergenic
991142963 5:63267889-63267911 TGATGGTTGGTGAAAGTTGGAGG + Intergenic
992288577 5:75261420-75261442 TGTAAAAGGTTGACAGTTGGAGG - Intergenic
993433586 5:87862761-87862783 TGTTGAATTGTGAGTGTTGGAGG + Intergenic
994001113 5:94780532-94780554 TGTTAAATGGTAGAATTTTGAGG + Intronic
994065575 5:95536558-95536580 TTTTTAATGGTGGAAATTGGAGG - Intronic
994709109 5:103244580-103244602 TGCTAAATTGTGATAGGTGGAGG + Intergenic
995455562 5:112348248-112348270 TGGTAAATGGACAAAGGTGGAGG - Intronic
995591740 5:113706766-113706788 TGTTATGTGGTGGAAGTAGGAGG + Intergenic
996091961 5:119360130-119360152 TGTTCAATGGCGTAAGGTGGGGG - Intronic
996957562 5:129202397-129202419 CGTTAAATGGTGAAAGGCAGAGG + Intergenic
997784068 5:136690870-136690892 TTTTATATGGTGAAAGGTAGTGG - Intergenic
998195206 5:140063109-140063131 TGGAAAATGTTGAGAGTTGGTGG - Intergenic
998479946 5:142454483-142454505 TGATAAATGCTGAGAGCTGGAGG - Intergenic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
999213151 5:149907594-149907616 TCTCAGATGGTGAAACTTGGTGG - Intronic
999719157 5:154385961-154385983 AGTTAAATGGTCCAAGTTGGGGG - Intronic
1000227372 5:159278252-159278274 TGTTATATGGGGAAAGTTTTCGG + Exonic
1000451709 5:161397349-161397371 TGCCAAATGGTAAAGGTTGGTGG - Intronic
1003225518 6:4202093-4202115 TGTTTAATGTTGACAGTGGGGGG + Intergenic
1003848511 6:10198383-10198405 TTTCAAATGGAGAAAGTGGGTGG - Intronic
1004366679 6:15018896-15018918 CTTTAAATGGTTAAAGTTAGAGG - Intergenic
1005064093 6:21801552-21801574 AGTGCAATGCTGAAAGTTGGAGG + Intergenic
1007158022 6:39764764-39764786 TGTTAAATGGTGAATCAAGGAGG + Intergenic
1007274612 6:40664051-40664073 TGGTAACTGATGAAAGTTAGTGG - Intergenic
1007350007 6:41264974-41264996 TTGTATATGGTGAAAGATGGGGG - Intergenic
1008199648 6:48570609-48570631 TTTTAAGTTGTGAAAGTTAGAGG + Intergenic
1008736690 6:54553172-54553194 TTTTATATGATGAAAGATGGGGG - Intergenic
1008876205 6:56331450-56331472 TTTTATATGGTGAAAGATGGGGG + Intronic
1009704517 6:67229485-67229507 TTGTATATGGTGAAAGATGGGGG - Intergenic
1009832923 6:68962064-68962086 AGTTTAATGGTGACAGTAGGTGG + Intronic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1013956519 6:115848353-115848375 TTGTATATGGTGAAAGTTAGGGG - Intergenic
1014274036 6:119366603-119366625 TCTCAAATGGTGAAAGATGAAGG + Intergenic
1014976064 6:127885856-127885878 TGATAAATGGTAAAAATTAGTGG + Intronic
1015175413 6:130301916-130301938 TTTTATATGGTGAGAGGTGGGGG - Intronic
1015656815 6:135527496-135527518 TGTTAGATGCTGAGACTTGGGGG + Intergenic
1016057347 6:139592613-139592635 TGATAAATGCTGAAAGGTGAAGG + Intergenic
1016096910 6:140049437-140049459 TAGTAAATGGGGAAAATTGGTGG + Intergenic
1018198520 6:161375511-161375533 TACAAAATGGTGAAACTTGGGGG - Intronic
1019526885 7:1484474-1484496 TGTGACCTAGTGAAAGTTGGTGG - Intronic
1019779161 7:2929559-2929581 TGTTAAATTGGGAAAGGAGGCGG + Intronic
1021441526 7:20682440-20682462 GGTTAAAAGGTGGGAGTTGGGGG + Intronic
1022593433 7:31688210-31688232 TGTTAAATGGGGGAAGATAGTGG - Intronic
1024318911 7:48045927-48045949 TGTTAAATGGTAAATGTTTAGGG + Intronic
1024375355 7:48631325-48631347 TTATACATGGTGAAAGATGGGGG + Intronic
1025605376 7:63036650-63036672 TGTCACATGGCGAAAGTAGGAGG - Intergenic
1026363924 7:69628614-69628636 ACTTACATGGTGAAAGTTGAAGG + Intronic
1026640772 7:72123347-72123369 TGATAAATGGTGGGAGTTGGAGG + Intronic
1027879702 7:83818789-83818811 TTTTAAAAGGTGAAAGTAGAGGG + Intergenic
1027949465 7:84795925-84795947 TTGTATATGGTGAAAGATGGGGG + Intergenic
1028199658 7:87946523-87946545 TTATATATGGTGAAAGTTAGGGG + Intronic
1029853688 7:103491162-103491184 TGTTTAAAGGTGATAGTCGGAGG + Intronic
1031185015 7:118466364-118466386 ATTTAAATCGTGAGAGTTGGAGG - Intergenic
1032302805 7:130704604-130704626 TCTTAAATGGTGCAACTTGATGG - Intergenic
1033725536 7:144112441-144112463 TTATATATGGTGAAAGTAGGGGG + Intergenic
1033796289 7:144849096-144849118 TTGTAAATGGTGAGAGGTGGGGG + Intergenic
1033859808 7:145610734-145610756 TACTACATGATGAAAGTTGGGGG - Intergenic
1034999205 7:155598145-155598167 GGTTAAATGGTGAAAGTAAAAGG - Intergenic
1038808998 8:30820780-30820802 TTGTATATGGTGAAAGCTGGGGG + Intergenic
1038872186 8:31506881-31506903 TTGCAAATGGTGAAAGATGGGGG + Intergenic
1040049732 8:43001461-43001483 TGTTAAATTATGAAATTTAGTGG + Intronic
1041223141 8:55671539-55671561 TGTTAAAAGGTGAAATTAAGAGG + Intergenic
1041833687 8:62186021-62186043 TATTAAAGGGTGAAATTTGTTGG - Intergenic
1042360299 8:67875318-67875340 TTTTATATGGTGAAAGTAAGGGG - Intergenic
1042917178 8:73886983-73887005 TTTTATAGGGTGAAAGTTGGGGG - Intergenic
1044731976 8:95236255-95236277 TGTTGTAAGATGAAAGTTGGTGG + Intergenic
1044862696 8:96538621-96538643 TGTTAATTGCTAAAAGTTGAAGG + Intronic
1045854273 8:106745418-106745440 TGTTTAATGGTAAAAGTTAATGG + Intronic
1046721139 8:117620361-117620383 TGGTATATAGTGAAAATTGGAGG - Intergenic
1050390609 9:5139846-5139868 TGTTAAATGATTAAAATTTGTGG - Intronic
1051308202 9:15739276-15739298 TGTTAAATTGTGAAAAGTAGTGG + Intronic
1051769346 9:20559353-20559375 TGTTAACTGGTTAAAGTAAGTGG + Intronic
1054752435 9:68921572-68921594 TTTTAAATAGAGAAAGGTGGGGG - Intronic
1055353177 9:75410878-75410900 TGTTAGATGGTGTTAGTTGCAGG - Intergenic
1055569560 9:77602737-77602759 TCTTAAATTGGGAAAGTTGTGGG - Intronic
1056311107 9:85341864-85341886 AGGTGAATGGTGAAAGTAGGAGG - Intergenic
1058000975 9:99864393-99864415 TAACAAATGGTGAAAGATGGAGG + Exonic
1058102631 9:100934263-100934285 TTGTATATGGTGAAAGGTGGGGG + Intergenic
1059516924 9:114904526-114904548 TCTTCAATGCTGAAAGCTGGAGG + Intronic
1187073577 X:15912241-15912263 TGTTAAATAGTGATAGTAGAGGG + Intergenic
1188059578 X:25584662-25584684 CGTAAAATGTTCAAAGTTGGAGG + Intergenic
1188361050 X:29254278-29254300 TATTAAATTTTGAAAGATGGTGG - Intronic
1188872697 X:35393235-35393257 GGTCTAATGGTGAAAGTTGATGG + Intergenic
1188924740 X:36024895-36024917 TGTTAAATGGTGACCTTTGCAGG + Intergenic
1188928591 X:36076910-36076932 TTGTATATGGTGAAAGTTAGGGG + Intronic
1189624443 X:42880950-42880972 TGTTAAATTGTGAATGTTTATGG - Intergenic
1191599364 X:62985895-62985917 TTTTATATGGTGAAAGATAGGGG + Intergenic
1193090232 X:77486200-77486222 TGTCACATGGTGAAAGCAGGAGG + Intergenic
1193489148 X:82126745-82126767 TGTCACATGGTGAGAGTAGGAGG + Intergenic
1194077257 X:89411695-89411717 TTTCAAATGGTGGAGGTTGGGGG - Intergenic
1194844741 X:98791070-98791092 TTTTATATGGTGAAAGGTAGGGG - Intergenic
1196514910 X:116598270-116598292 TTGTATATGGTGAAAGATGGGGG + Intergenic
1196753877 X:119140978-119141000 TGTTCATTTGTGATAGTTGGAGG - Intronic
1197003058 X:121461831-121461853 TGATAAATGGTGAGAGATAGTGG + Intergenic
1197173958 X:123465036-123465058 TGTGATACGATGAAAGTTGGTGG + Exonic
1197642114 X:128978204-128978226 TGTCACATGGTGAAAGCAGGTGG + Intergenic
1197993644 X:132347582-132347604 TTGTATATGGTGAAAGTTAGCGG - Intergenic
1198731361 X:139733543-139733565 CCTTAAATGAAGAAAGTTGGTGG + Intronic
1198759162 X:140012759-140012781 TTTTATATGGTGAAAGGTAGGGG + Intergenic
1198779577 X:140220813-140220835 TTTTATATGGTGAAAGGTAGGGG - Intergenic
1199026566 X:142946063-142946085 TTTTAAAAGGACAAAGTTGGAGG + Intergenic
1200429903 Y:3067241-3067263 TTTCAAATGGTGAAGGTTGGGGG - Intergenic
1200758659 Y:7016011-7016033 TGTTAGATTCTGAAAGCTGGTGG + Intronic
1201698136 Y:16850541-16850563 TGCTAAATTGTGGAAGTTTGGGG - Intergenic
1201762232 Y:17553217-17553239 AGATAAATAGAGAAAGTTGGGGG + Intergenic
1201839320 Y:18352771-18352793 AGATAAATAGAGAAAGTTGGGGG - Intergenic