ID: 1142841115

View in Genome Browser
Species Human (GRCh38)
Location 17:2631393-2631415
Sequence TGTAACCATCTGAATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142841115_1142841122 10 Left 1142841115 17:2631393-2631415 CCCACCCCATTCAGATGGTTACA 0: 1
1: 0
2: 1
3: 13
4: 114
Right 1142841122 17:2631426-2631448 AGAGAATTCCTTCTCCCTGTGGG 0: 1
1: 2
2: 5
3: 43
4: 258
1142841115_1142841121 9 Left 1142841115 17:2631393-2631415 CCCACCCCATTCAGATGGTTACA 0: 1
1: 0
2: 1
3: 13
4: 114
Right 1142841121 17:2631425-2631447 TAGAGAATTCCTTCTCCCTGTGG 0: 38
1: 75
2: 123
3: 191
4: 401
1142841115_1142841123 11 Left 1142841115 17:2631393-2631415 CCCACCCCATTCAGATGGTTACA 0: 1
1: 0
2: 1
3: 13
4: 114
Right 1142841123 17:2631427-2631449 GAGAATTCCTTCTCCCTGTGGGG 0: 1
1: 0
2: 3
3: 46
4: 1460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142841115 Original CRISPR TGTAACCATCTGAATGGGGT GGG (reversed) Intronic
906788100 1:48633898-48633920 TGGAACCATGTGGATGGAGTTGG - Intronic
908742897 1:67346789-67346811 TGTAACCAACTGAATGGCATTGG + Intronic
909692947 1:78430713-78430735 TTTAACCACTTGAAGGGGGTTGG + Intronic
911609426 1:99944513-99944535 GCTAACAATCTGAATGGGTTTGG - Intergenic
916236635 1:162595372-162595394 TATATACATCTTAATGGGGTGGG + Intronic
916792437 1:168136447-168136469 TGCACCCAGCAGAATGGGGTGGG + Intronic
917587658 1:176444135-176444157 TGGAACTATGTGATTGGGGTGGG + Intergenic
917784051 1:178433247-178433269 TGTAACCATCTTCATGGGGATGG - Intronic
919542012 1:198859178-198859200 TGTAAGTATCTGAAGGGGATGGG + Intergenic
919882114 1:201907641-201907663 TGTCACCATAGGACTGGGGTGGG - Intronic
923390525 1:233510537-233510559 TGTAACCATCAGAAAAGGGGCGG - Intergenic
1063715341 10:8521179-8521201 TGTACCCATATTTATGGGGTGGG + Intergenic
1066319933 10:34292154-34292176 TTTTACCCTCTGAATGGGTTTGG - Intronic
1066447661 10:35498478-35498500 TGTAAACTTCAGACTGGGGTGGG - Intronic
1067168215 10:43882231-43882253 TGTGACCATCAGAAGAGGGTGGG - Intergenic
1069353581 10:67558482-67558504 TGAAACTATCTGAATGCGGCTGG + Intronic
1069802466 10:71090615-71090637 TGAAAGCTTCTCAATGGGGTGGG + Intergenic
1072550412 10:96473049-96473071 TGTTCCCATCTGATTGGGGGGGG - Intronic
1074182243 10:111075845-111075867 TGTGTACATCTGAATGGGGGTGG + Intergenic
1074583093 10:114739762-114739784 TTTAACCATCTGAATGGAAGTGG - Intergenic
1075288401 10:121207242-121207264 TGTAACCATCCCTATGTGGTAGG + Intergenic
1079411918 11:20196008-20196030 TTCTACCAACTGAATGGGGTTGG - Intergenic
1084730030 11:71066936-71066958 TGTAACCCACTGACTGGGGAAGG - Intronic
1089011487 11:115135734-115135756 TGGCACCATCTGAAGGGGGCAGG - Intergenic
1108935187 13:55873790-55873812 TGTGAACAGCTGAATGGGGGTGG - Intergenic
1109507428 13:63323442-63323464 TGTAACAATATGAATGGGCTTGG + Intergenic
1112266827 13:97932062-97932084 TGTAACCATATTAAGAGGGTGGG - Intergenic
1112810910 13:103217448-103217470 TTCAACCATCAGGATGGGGTGGG - Intergenic
1112978539 13:105352209-105352231 TGGAACCCTCTGGATGGGGAAGG - Intergenic
1113573918 13:111381572-111381594 TCTCACCATCTGAAAGGGGCAGG - Intergenic
1115320868 14:32077534-32077556 TGTAACCAGTTGAAGGGGCTGGG + Intronic
1117787959 14:59306907-59306929 TGTAATGGTCAGAATGGGGTAGG + Intronic
1118899753 14:69976630-69976652 TTTTACCATCTGAATGGAGGTGG - Intronic
1119309365 14:73633717-73633739 TGGAACCATCTGGAAGAGGTAGG - Intergenic
1127681705 15:61304063-61304085 TGATACCATCTGTACGGGGTTGG - Intergenic
1133072516 16:3255947-3255969 TGCAATCATATGAACGGGGTTGG - Intronic
1135303871 16:21352549-21352571 AATAACCATCTGAAGGGGGTGGG - Intergenic
1136300605 16:29331686-29331708 AATAACCATCTGAAGGGGGTGGG - Intergenic
1138119739 16:54390118-54390140 TGTAACCAAATGTTTGGGGTCGG - Intergenic
1138493382 16:57391513-57391535 TGTATCCATCAGGATGGGCTAGG - Intergenic
1139079261 16:63495167-63495189 TCTAACAATCTGAATGAGTTTGG - Intergenic
1140702968 16:77599464-77599486 TGTAAACATCTTAATGAGTTTGG + Intergenic
1142062338 16:88038479-88038501 AATAACCATCTGAAGGGGGTGGG - Intronic
1142841115 17:2631393-2631415 TGTAACCATCTGAATGGGGTGGG - Intronic
1144306015 17:13970225-13970247 TGCAACCATCTGATTGGTTTTGG - Intergenic
1145251680 17:21300220-21300242 TCTAGCCAGCTGAGTGGGGTCGG + Intronic
1149603270 17:57907097-57907119 TGTCCCCATCTGCATGGAGTGGG + Intronic
1151102239 17:71569345-71569367 GGTAAGCTTCTGAATGGGGGTGG - Intergenic
1151179801 17:72318992-72319014 AGTCTCCATCTGAATGGAGTTGG + Intergenic
1153679669 18:7488618-7488640 TGGAACCATGTGAATGGGGATGG + Intergenic
1155558241 18:27046144-27046166 TGTAAACATGTGCAGGGGGTTGG - Intronic
1162755402 19:12855502-12855524 TGGAACCAGCTGAGTGGGGGTGG + Intronic
1166648932 19:44555540-44555562 TGCCACCATCTGAATGAGCTTGG + Intergenic
925177748 2:1797133-1797155 TGAATCCAGTTGAATGGGGTTGG + Intronic
927362050 2:22247566-22247588 TGGAACCAAGTGAATGGGTTTGG - Intergenic
928847332 2:35692912-35692934 TGCAACAATATGAATGGAGTTGG - Intergenic
930376511 2:50573975-50573997 TATAACCATCTGAGGGGGATTGG - Intronic
931649633 2:64455575-64455597 TGGAACTATCTGAAAAGGGTGGG - Exonic
935487970 2:103681449-103681471 TGAACACATCTGAAGGGGGTTGG - Intergenic
939286461 2:140136878-140136900 TGGACCCCTCTGAAGGGGGTGGG + Intergenic
941675708 2:168341474-168341496 TGTAACCATGTGAATGGATCTGG - Intergenic
943943963 2:194034745-194034767 TATGGCAATCTGAATGGGGTTGG + Intergenic
944483215 2:200178316-200178338 TGTAGCCAGCTGGAAGGGGTGGG - Intergenic
1170138758 20:13104216-13104238 TATAACCATCTGATAGGGTTTGG + Intronic
1172673906 20:36653978-36654000 TGTCACTGTCTGAATGGTGTGGG - Intronic
1173309360 20:41883159-41883181 TGTATCCATCTGAATCGCATTGG + Intergenic
1178636616 21:34309178-34309200 TGAAACCATCTGAATGGATAGGG - Intergenic
1179655433 21:42841814-42841836 TGCAGCGAGCTGAATGGGGTGGG - Intergenic
949366180 3:3283516-3283538 TTTAACCATTTGTCTGGGGTTGG + Intergenic
961197752 3:125017529-125017551 TATAGCCATCTGAGTGGGGGTGG - Intronic
961822603 3:129582818-129582840 TTTAATCAACTAAATGGGGTGGG - Intronic
962969175 3:140382929-140382951 TTTAAACATATGAATTGGGTGGG + Intronic
963998680 3:151740720-151740742 TGTATTCATCTGAAAGTGGTTGG - Exonic
964601325 3:158503898-158503920 TGTAACAATTTGAATGGGATGGG - Intronic
965321971 3:167261886-167261908 TGTAACCATTTGATTGGGGTGGG - Intronic
966190487 3:177267993-177268015 TGTAACAATTTGAATGGAGCTGG - Intergenic
967630724 3:191740804-191740826 TGCAAACAGCTGAATGGGGGTGG - Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969548420 4:7847824-7847846 TGTAGACATCTGAATGGGTCGGG - Intronic
971498034 4:27288653-27288675 GGTATCCATGTGAATGGGGTTGG + Intergenic
978991095 4:115083566-115083588 TGTAACCATCTAAAATGGTTTGG + Intronic
979589212 4:122459218-122459240 TGTAAAAATCTGAATGAGCTCGG + Intergenic
982680221 4:158419411-158419433 TGTAGCAATTTGAGTGGGGTGGG - Intronic
983307900 4:166017234-166017256 TGTAGCCATGTGAATGGAGCTGG - Intronic
984181233 4:176484746-176484768 TGTCACCAACTGAAGGAGGTAGG - Intergenic
987539745 5:19238928-19238950 GGTAAGCATGTGAATGGTGTGGG + Intergenic
992234226 5:74692690-74692712 TGTGAGCATCTGAATGGTGGTGG + Intronic
993117380 5:83734411-83734433 TATAACCATCAGATTGGGGGTGG - Intergenic
993299243 5:86186064-86186086 TGTAAACATCTGATTGGCCTTGG - Intergenic
994398313 5:99247225-99247247 TGAGACCATCTGATTAGGGTGGG + Intergenic
994999346 5:107107176-107107198 TGTGACCATGGGAGTGGGGTGGG - Intergenic
997151979 5:131506819-131506841 TTTAAACAACTGAATGGAGTGGG - Intronic
997876518 5:137553020-137553042 TGCAACAATCTGGATGGAGTTGG - Intronic
999541972 5:152584299-152584321 TGGAACAATCTGCTTGGGGTTGG + Intergenic
1002891394 6:1335783-1335805 TGGAAGGATGTGAATGGGGTTGG + Intergenic
1004738576 6:18433232-18433254 TGTAAGGATCTGAATGGGAAGGG + Intronic
1008222270 6:48869375-48869397 TGTAACCATCTCAATGATGACGG - Intergenic
1008422751 6:51321357-51321379 TCTAAGCACCAGAATGGGGTTGG - Intergenic
1011477179 6:87759557-87759579 AGTGACCATCTGCATGGGGTAGG - Intergenic
1013184055 6:107741949-107741971 TGTTACCATCTTATTAGGGTCGG - Intronic
1014825671 6:126046582-126046604 TGTACCCATCTGAATATGCTGGG + Intergenic
1020361928 7:7336038-7336060 TTTAAGCAGCTGAATGTGGTTGG + Intergenic
1020915185 7:14184260-14184282 TGTAACAATTTGAACGGGGTGGG + Intronic
1023301061 7:38771909-38771931 TGTCACCATCTGAAAGGATTTGG - Intronic
1024500724 7:50102397-50102419 TGCAACAATCTGAATGCGCTTGG - Intronic
1024659246 7:51477436-51477458 TGTAAGCATGTGAATGGTGTGGG + Intergenic
1026953845 7:74364519-74364541 TGTCAGCAGCTGGATGGGGTGGG + Intronic
1031964561 7:128018338-128018360 TGTCAGCAGCTGGATGGGGTTGG - Intronic
1032306626 7:130739359-130739381 TGCAAGCTTCTGAATGGGCTTGG - Intergenic
1040454124 8:47578887-47578909 TGTAACTGTCTGACTTGGGTAGG + Intronic
1040774529 8:51023782-51023804 TGAAACCATCTGTGTGGGGCAGG - Intergenic
1048806962 8:138250055-138250077 TCAAACCATATGAATGGGCTGGG + Intronic
1050293409 9:4180292-4180314 TGGAAGAATGTGAATGGGGTAGG - Intronic
1051657533 9:19397304-19397326 GGTAGCCATCTGAACGGAGTTGG + Intergenic
1052062004 9:23971782-23971804 AGTAACCAACTGAAAGAGGTGGG - Intergenic
1052957348 9:34263636-34263658 ATAAACTATCTGAATGGGGTAGG + Intronic
1054912770 9:70469187-70469209 TGTAGCCATCTGACTGGTTTTGG - Intergenic
1055018387 9:71643711-71643733 TTTGAGCACCTGAATGGGGTTGG - Intergenic
1057849210 9:98551590-98551612 TTTAACCAGCAGCATGGGGTGGG + Intronic
1059553447 9:115253569-115253591 GCTAACAACCTGAATGGGGTTGG - Intronic
1061404852 9:130387974-130387996 TGTAGCCATCAGAAAGGGCTGGG - Intronic
1186210106 X:7241866-7241888 TGCAACTATCTGAATGAGCTTGG - Intronic
1189200657 X:39193133-39193155 TGTAACCTTGTGAATCAGGTAGG - Intergenic
1190503058 X:51098119-51098141 TGTCACCTGCTGCATGGGGTTGG - Intergenic
1192453908 X:71261776-71261798 AGTAAACATCTGAATGGGAATGG + Intergenic
1197127386 X:122963220-122963242 TGTGAGCATTTGATTGGGGTGGG + Intergenic
1198576388 X:138014497-138014519 TGTAACCAACTGAAGTGGGACGG - Intergenic
1198993810 X:142548928-142548950 TTTAATCATGTGAATGGGGTTGG + Intergenic
1199596576 X:149510742-149510764 TGCATTCATCTGAATGGAGTGGG + Intronic