ID: 1142841269

View in Genome Browser
Species Human (GRCh38)
Location 17:2632797-2632819
Sequence TCCCTGATAAAAAATGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 1, 2: 6, 3: 44, 4: 376}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142841269_1142841274 10 Left 1142841269 17:2632797-2632819 CCTACACCATTTTTTATCAGGGA 0: 1
1: 1
2: 6
3: 44
4: 376
Right 1142841274 17:2632830-2632852 CTCGGATACCAAAATCCTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 73
1142841269_1142841271 -8 Left 1142841269 17:2632797-2632819 CCTACACCATTTTTTATCAGGGA 0: 1
1: 1
2: 6
3: 44
4: 376
Right 1142841271 17:2632812-2632834 ATCAGGGATATGAGCAACCTCGG 0: 1
1: 0
2: 5
3: 46
4: 317
1142841269_1142841272 7 Left 1142841269 17:2632797-2632819 CCTACACCATTTTTTATCAGGGA 0: 1
1: 1
2: 6
3: 44
4: 376
Right 1142841272 17:2632827-2632849 AACCTCGGATACCAAAATCCTGG 0: 1
1: 0
2: 1
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142841269 Original CRISPR TCCCTGATAAAAAATGGTGT AGG (reversed) Intronic