ID: 1142841270

View in Genome Browser
Species Human (GRCh38)
Location 17:2632803-2632825
Sequence CTCATATCCCTGATAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1370
Summary {0: 1, 1: 0, 2: 32, 3: 347, 4: 990}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142841270_1142841272 1 Left 1142841270 17:2632803-2632825 CCATTTTTTATCAGGGATATGAG 0: 1
1: 0
2: 32
3: 347
4: 990
Right 1142841272 17:2632827-2632849 AACCTCGGATACCAAAATCCTGG 0: 1
1: 0
2: 1
3: 9
4: 108
1142841270_1142841277 26 Left 1142841270 17:2632803-2632825 CCATTTTTTATCAGGGATATGAG 0: 1
1: 0
2: 32
3: 347
4: 990
Right 1142841277 17:2632852-2632874 GTCCTAGAACCATTGCCCCATGG 0: 1
1: 0
2: 36
3: 254
4: 606
1142841270_1142841274 4 Left 1142841270 17:2632803-2632825 CCATTTTTTATCAGGGATATGAG 0: 1
1: 0
2: 32
3: 347
4: 990
Right 1142841274 17:2632830-2632852 CTCGGATACCAAAATCCTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142841270 Original CRISPR CTCATATCCCTGATAAAAAA TGG (reversed) Intronic