ID: 1142841274 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:2632830-2632852 |
| Sequence | CTCGGATACCAAAATCCTGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 80 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 73} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1142841270_1142841274 | 4 | Left | 1142841270 | 17:2632803-2632825 | CCATTTTTTATCAGGGATATGAG | 0: 1 1: 0 2: 32 3: 347 4: 990 |
||
| Right | 1142841274 | 17:2632830-2632852 | CTCGGATACCAAAATCCTGGAGG | 0: 1 1: 0 2: 0 3: 6 4: 73 |
||||
| 1142841269_1142841274 | 10 | Left | 1142841269 | 17:2632797-2632819 | CCTACACCATTTTTTATCAGGGA | 0: 1 1: 1 2: 6 3: 44 4: 376 |
||
| Right | 1142841274 | 17:2632830-2632852 | CTCGGATACCAAAATCCTGGAGG | 0: 1 1: 0 2: 0 3: 6 4: 73 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1142841274 | Original CRISPR | CTCGGATACCAAAATCCTGG AGG | Intronic | ||