ID: 1142841274

View in Genome Browser
Species Human (GRCh38)
Location 17:2632830-2632852
Sequence CTCGGATACCAAAATCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142841270_1142841274 4 Left 1142841270 17:2632803-2632825 CCATTTTTTATCAGGGATATGAG 0: 1
1: 0
2: 32
3: 347
4: 990
Right 1142841274 17:2632830-2632852 CTCGGATACCAAAATCCTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 73
1142841269_1142841274 10 Left 1142841269 17:2632797-2632819 CCTACACCATTTTTTATCAGGGA 0: 1
1: 1
2: 6
3: 44
4: 376
Right 1142841274 17:2632830-2632852 CTCGGATACCAAAATCCTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142841274 Original CRISPR CTCGGATACCAAAATCCTGG AGG Intronic