ID: 1142842347

View in Genome Browser
Species Human (GRCh38)
Location 17:2643366-2643388
Sequence GCCTCTGCCCCCCTAATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243457
Summary {0: 1, 1: 9, 2: 624, 3: 18128, 4: 224695}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142842345_1142842347 -1 Left 1142842345 17:2643344-2643366 CCTGGGCTCAAGCTATTCTCCTG 0: 98
1: 5524
2: 96341
3: 246040
4: 247526
Right 1142842347 17:2643366-2643388 GCCTCTGCCCCCCTAATAGCTGG 0: 1
1: 9
2: 624
3: 18128
4: 224695
1142842341_1142842347 18 Left 1142842341 17:2643325-2643347 CCCAGGCAGGTCTCGAACTCCTG 0: 163
1: 9640
2: 53338
3: 66815
4: 49177
Right 1142842347 17:2643366-2643388 GCCTCTGCCCCCCTAATAGCTGG 0: 1
1: 9
2: 624
3: 18128
4: 224695
1142842342_1142842347 17 Left 1142842342 17:2643326-2643348 CCAGGCAGGTCTCGAACTCCTGG 0: 179
1: 10730
2: 106343
3: 213015
4: 213534
Right 1142842347 17:2643366-2643388 GCCTCTGCCCCCCTAATAGCTGG 0: 1
1: 9
2: 624
3: 18128
4: 224695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142842347 Original CRISPR GCCTCTGCCCCCCTAATAGC TGG Intronic
Too many off-targets to display for this crispr