ID: 1142847575

View in Genome Browser
Species Human (GRCh38)
Location 17:2689742-2689764
Sequence ACGTCGGCACCTGTAACTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142847573_1142847575 -7 Left 1142847573 17:2689726-2689748 CCAGAGAAGCGACATCACGTCGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1142847575 17:2689742-2689764 ACGTCGGCACCTGTAACTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 47
1142847567_1142847575 29 Left 1142847567 17:2689690-2689712 CCAGAGCTAGTCTCAGACCAGGA 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1142847575 17:2689742-2689764 ACGTCGGCACCTGTAACTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 47
1142847565_1142847575 30 Left 1142847565 17:2689689-2689711 CCCAGAGCTAGTCTCAGACCAGG 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1142847575 17:2689742-2689764 ACGTCGGCACCTGTAACTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 47
1142847572_1142847575 12 Left 1142847572 17:2689707-2689729 CCAGGAAGGGAGCTGGGCACCAG 0: 1
1: 1
2: 6
3: 61
4: 556
Right 1142847575 17:2689742-2689764 ACGTCGGCACCTGTAACTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142847575 Original CRISPR ACGTCGGCACCTGTAACTCC CGG Exonic
910664730 1:89712243-89712265 TGGTAGGCACCTGTAATTCCAGG - Intronic
912809693 1:112784680-112784702 TGGTGGGCACCTGTAACCCCAGG - Intergenic
922062257 1:222104012-222104034 AAGACGCCACCTGTATCTCCAGG - Intergenic
1063137438 10:3229624-3229646 ACCTCAGCACATGGAACTCCGGG + Intergenic
1065011697 10:21426981-21427003 ACGTGGGAACCTGCAACTCCTGG + Intergenic
1065970855 10:30805117-30805139 ACGTCGGCACAAGTCATTCCAGG + Intergenic
1069728121 10:70594226-70594248 AGGTCGGCACCTGCATCCCCTGG + Intergenic
1073933397 10:108601380-108601402 AGGTTGGCACCTCCAACTCCAGG - Intergenic
1075684777 10:124355868-124355890 TGGTGGGCGCCTGTAACTCCAGG + Intergenic
1078888061 11:15525805-15525827 AGGCCAGCACCTGTAACTCCAGG + Intergenic
1084220591 11:67675163-67675185 GCGACGGCACCTGTAGCTCTAGG + Intronic
1090093043 11:123716198-123716220 ACCTCGGCACCTGAAAGTGCTGG + Intergenic
1091636847 12:2203589-2203611 AAGCCGGTACCTGTACCTCCAGG + Intronic
1098696294 12:73560212-73560234 AAATCTGCACATGTAACTCCAGG + Intergenic
1098815277 12:75153312-75153334 AGATTGGCACCTATAACTCCTGG - Intronic
1133968662 16:10550840-10550862 TGGTGGGCACCTGTAATTCCAGG + Intronic
1134778437 16:16873240-16873262 TGGTGGGCACCTGTAATTCCAGG + Intergenic
1135863902 16:26082776-26082798 AAGTTGGCACCTGGAATTCCAGG - Intronic
1142847575 17:2689742-2689764 ACGTCGGCACCTGTAACTCCCGG + Exonic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1152451924 17:80387038-80387060 ACCACGCCACCTGTATCTCCGGG + Intronic
1159975559 18:74707198-74707220 ACGTCGGCATCTGAAAGTGCTGG + Intronic
1165527195 19:36366133-36366155 TGGTGGGCGCCTGTAACTCCAGG + Intronic
1165697976 19:37915512-37915534 CGGTGGGCGCCTGTAACTCCAGG - Intronic
1166291923 19:41869038-41869060 AGCGCGGCACCTGTACCTCCGGG + Exonic
1167422101 19:49409919-49409941 AGGGCGGCACCTGGAGCTCCTGG - Intronic
925337272 2:3107639-3107661 ACGTCGGCACATCCAACTCTTGG + Intergenic
925850697 2:8078416-8078438 ACGTCAGTACCTGGAACTTCAGG - Intergenic
927467427 2:23347882-23347904 ACGTCTCCACCTTTATCTCCAGG - Intergenic
935993033 2:108738759-108738781 TGGTAGGCACCTGTAATTCCAGG - Intronic
939110502 2:138001020-138001042 ACAAAGGTACCTGTAACTCCTGG + Exonic
940634313 2:156278985-156279007 CTGTCCCCACCTGTAACTCCTGG - Intergenic
943287204 2:186016952-186016974 TCGTGGGCACCTGTAATCCCAGG + Intergenic
1170678588 20:18504812-18504834 AGCGCGGCACCTGTACCTCCAGG + Intergenic
1174287469 20:49483220-49483242 AGGTGGGCACCTGGAACCCCCGG - Intergenic
1174932993 20:54835997-54836019 ACGTGCGCACCTGTAATCCCAGG - Intergenic
1184484353 22:44767041-44767063 AGGATGGCTCCTGTAACTCCCGG - Intronic
974702110 4:65465301-65465323 TCGTGGGCACCTGTAATCCCAGG + Intronic
986237504 5:5925878-5925900 AAGTCAGCACATGTAACTACAGG + Intergenic
996185191 5:120465280-120465302 ACGTCGTTACCAGTAACTCTGGG + Intronic
1001317411 5:170653759-170653781 ATGTGGCCACCAGTAACTCCAGG + Intronic
1006340428 6:33443606-33443628 CCGTCGGCAGCTTTCACTCCAGG + Exonic
1014243616 6:119043634-119043656 ACCTCGGCACCTTTAGCCCCAGG + Intronic
1016868109 6:148789728-148789750 TGGTGGGCACCTGTAATTCCAGG - Intronic
1021959665 7:25859024-25859046 CGGTCGGGGCCTGTAACTCCAGG + Intergenic
1034631823 7:152536988-152537010 AGGTGGGCACCTGTAATTCTAGG + Intergenic
1049295293 8:141830087-141830109 ACTCCGGCACCTGGAGCTCCAGG - Intergenic
1058742788 9:107960563-107960585 TGGTGGGCACCTGTAATTCCAGG + Intergenic
1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG + Intronic
1192180136 X:68911108-68911130 ACTCTGGCAACTGTAACTCCAGG - Intergenic
1196279796 X:113810663-113810685 ACTTTGACATCTGTAACTCCAGG - Intergenic