ID: 1142848167

View in Genome Browser
Species Human (GRCh38)
Location 17:2691998-2692020
Sequence GCGCACCTGCGTCTTGTAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 35}

Found 24 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142848147_1142848167 12 Left 1142848147 17:2691963-2691985 CCCCGCCCCGCCCCCGCCCCCGC 0: 10
1: 66
2: 413
3: 1722
4: 8958
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848151_1142848167 6 Left 1142848151 17:2691969-2691991 CCCGCCCCCGCCCCCGCCACGCC 0: 1
1: 17
2: 101
3: 786
4: 3889
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848148_1142848167 11 Left 1142848148 17:2691964-2691986 CCCGCCCCGCCCCCGCCCCCGCC 0: 13
1: 158
2: 480
3: 2142
4: 10563
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848158_1142848167 -5 Left 1142848158 17:2691980-2692002 CCCCGCCACGCCCCCGCCGCGCA 0: 1
1: 0
2: 7
3: 70
4: 656
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848145_1142848167 18 Left 1142848145 17:2691957-2691979 CCACGCCCCCGCCCCGCCCCCGC 0: 5
1: 49
2: 345
3: 1446
4: 7087
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848155_1142848167 0 Left 1142848155 17:2691975-2691997 CCCGCCCCCGCCACGCCCCCGCC 0: 1
1: 5
2: 84
3: 650
4: 3440
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848152_1142848167 5 Left 1142848152 17:2691970-2691992 CCGCCCCCGCCCCCGCCACGCCC 0: 1
1: 14
2: 137
3: 1101
4: 6136
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848157_1142848167 -4 Left 1142848157 17:2691979-2692001 CCCCCGCCACGCCCCCGCCGCGC 0: 1
1: 2
2: 19
3: 206
4: 1277
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848143_1142848167 22 Left 1142848143 17:2691953-2691975 CCCGCCACGCCCCCGCCCCGCCC 0: 1
1: 16
2: 118
3: 657
4: 3414
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848160_1142848167 -7 Left 1142848160 17:2691982-2692004 CCGCCACGCCCCCGCCGCGCACC 0: 1
1: 0
2: 5
3: 82
4: 917
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848150_1142848167 7 Left 1142848150 17:2691968-2691990 CCCCGCCCCCGCCCCCGCCACGC 0: 1
1: 21
2: 131
3: 786
4: 3423
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848140_1142848167 27 Left 1142848140 17:2691948-2691970 CCCGCCCCGCCACGCCCCCGCCC 0: 1
1: 14
2: 106
3: 834
4: 3463
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848138_1142848167 29 Left 1142848138 17:2691946-2691968 CCCCCGCCCCGCCACGCCCCCGC 0: 1
1: 7
2: 49
3: 445
4: 2602
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848144_1142848167 21 Left 1142848144 17:2691954-2691976 CCGCCACGCCCCCGCCCCGCCCC 0: 1
1: 14
2: 135
3: 837
4: 5223
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848153_1142848167 2 Left 1142848153 17:2691973-2691995 CCCCCGCCCCCGCCACGCCCCCG 0: 1
1: 3
2: 42
3: 434
4: 3031
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848161_1142848167 -10 Left 1142848161 17:2691985-2692007 CCACGCCCCCGCCGCGCACCTGC 0: 1
1: 1
2: 16
3: 109
4: 896
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848139_1142848167 28 Left 1142848139 17:2691947-2691969 CCCCGCCCCGCCACGCCCCCGCC 0: 1
1: 8
2: 84
3: 721
4: 3366
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848149_1142848167 10 Left 1142848149 17:2691965-2691987 CCGCCCCGCCCCCGCCCCCGCCA 0: 2
1: 32
2: 190
3: 1083
4: 5940
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848154_1142848167 1 Left 1142848154 17:2691974-2691996 CCCCGCCCCCGCCACGCCCCCGC 0: 3
1: 9
2: 74
3: 542
4: 2606
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848159_1142848167 -6 Left 1142848159 17:2691981-2692003 CCCGCCACGCCCCCGCCGCGCAC 0: 1
1: 0
2: 9
3: 106
4: 783
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848142_1142848167 23 Left 1142848142 17:2691952-2691974 CCCCGCCACGCCCCCGCCCCGCC 0: 1
1: 9
2: 92
3: 582
4: 2906
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848141_1142848167 26 Left 1142848141 17:2691949-2691971 CCGCCCCGCCACGCCCCCGCCCC 0: 1
1: 9
2: 104
3: 825
4: 4455
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848146_1142848167 13 Left 1142848146 17:2691962-2691984 CCCCCGCCCCGCCCCCGCCCCCG 0: 7
1: 36
2: 313
3: 1487
4: 6895
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35
1142848156_1142848167 -1 Left 1142848156 17:2691976-2691998 CCGCCCCCGCCACGCCCCCGCCG 0: 1
1: 4
2: 41
3: 356
4: 2407
Right 1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG 0: 1
1: 0
2: 1
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142848167 Original CRISPR GCGCACCTGCGTCTTGTAGA TGG Exonic