ID: 1142849745

View in Genome Browser
Species Human (GRCh38)
Location 17:2698630-2698652
Sequence CACAAGAGCCTGCATCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142849738_1142849745 17 Left 1142849738 17:2698590-2698612 CCTGGCGGGGGTCGAGGAGGGCA 0: 1
1: 0
2: 1
3: 24
4: 238
Right 1142849745 17:2698630-2698652 CACAAGAGCCTGCATCCACCTGG 0: 1
1: 0
2: 0
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142849745 Original CRISPR CACAAGAGCCTGCATCCACC TGG Intronic
900648445 1:3719429-3719451 GACAAGAGCCTGCCACCACCTGG + Intronic
901069440 1:6509817-6509839 CACAAGACCCTGCACGCACAGGG + Intronic
902957820 1:19938033-19938055 CAGAAAAGCCTTCATCAACCTGG - Intergenic
906188136 1:43877331-43877353 CAGAAGACCCTGCACCCACGTGG - Intronic
907390456 1:54154796-54154818 CACCAGACCCTGCACCCAGCAGG - Intronic
908010350 1:59769845-59769867 CACAAGATCCTTCAACCACAAGG - Intergenic
909712949 1:78673194-78673216 CACAAGTGCCTGCATCGCCTTGG - Intergenic
915330755 1:155110926-155110948 CAGAAGAGCCTGCAAGAACCAGG - Intergenic
916042455 1:160973058-160973080 CACAAGAACCTTCAACTACCTGG + Intergenic
919887288 1:201944096-201944118 CAGAACAGCCTACATCCACAAGG + Intronic
920578287 1:207079518-207079540 CAGAAGACCCTCCATTCACCTGG - Intronic
920723304 1:208410377-208410399 CACTAGTGACTGCATCCAGCGGG + Intergenic
922989649 1:229895552-229895574 TAGAACAGCCTGCATCAACCTGG - Intergenic
923103665 1:230837657-230837679 CACAGGAGCCTGTGTCCTCCAGG + Exonic
1063610976 10:7561784-7561806 CACAAGAGGCTTCTTCCACGGGG - Exonic
1065588139 10:27240466-27240488 CCCAAGAGCCTGCATGAAACTGG + Exonic
1068082673 10:52339021-52339043 CACTAGAGCATCCATCCAGCTGG - Intergenic
1070319487 10:75343868-75343890 CACAAGGCCTTGCACCCACCAGG - Intergenic
1070724200 10:78777392-78777414 CTCTAGTGCCTGCATCCACAAGG + Intergenic
1072610174 10:97012687-97012709 CACAAGAGCCTCCATCCAAATGG - Intronic
1075533715 10:123252683-123252705 CTCTAGAGACTGCATCCACTTGG + Intergenic
1076806565 10:132862032-132862054 CGCCACAGCCTGCATGCACCTGG + Intronic
1077250858 11:1560075-1560097 CCCAAGAGCTGGCAGCCACCAGG - Intronic
1078897956 11:15614874-15614896 CACCAGAGCCTGCATCCCTGTGG - Intergenic
1079742871 11:24085867-24085889 CAAAAGAGAGTGCTTCCACCAGG + Intergenic
1080115165 11:28614109-28614131 CAGAAGAGGCTGCCTCCACATGG - Intergenic
1081490204 11:43562004-43562026 CCCAAGAGCATACATCCACATGG - Intronic
1084567987 11:69942469-69942491 GACCAGAGCCTGCTGCCACCTGG + Intergenic
1084717631 11:70883748-70883770 AACAAGACCCGGCCTCCACCTGG + Intronic
1085704552 11:78774842-78774864 CACAAAGTCCAGCATCCACCAGG - Intronic
1086346141 11:85899290-85899312 CTCATGAGCCTGCTTCCTCCTGG + Intronic
1091680819 12:2525330-2525352 GGAAAGAGCCTGCATCCACTGGG + Intronic
1091852763 12:3713556-3713578 CACAAGGGCCTGCTCCCATCAGG - Intronic
1094503798 12:31043147-31043169 CACAACACCCAGCATCCAGCCGG - Intergenic
1097280540 12:57843148-57843170 CGGAAGAGGCTGCCTCCACCAGG + Intronic
1097877486 12:64657083-64657105 CACTACAGCCTCCATCAACCAGG + Intronic
1102514881 12:113439778-113439800 CACAAGAGGCAGCATCCAGGAGG - Intergenic
1102998059 12:117364834-117364856 CACAATAACCTGATTCCACCAGG + Intronic
1104899854 12:132182981-132183003 GACAAGAGCTTGAAGCCACCAGG - Intergenic
1105630270 13:22156872-22156894 CATAAGGGCCTGCAACCACCAGG - Intergenic
1106351852 13:28938024-28938046 CTCAGGAGCCTGCATGCACAAGG - Intronic
1107798062 13:44075165-44075187 CTCAAGAGCCTGCATCATACAGG - Intergenic
1110454231 13:75672140-75672162 CACAAGAGTGTGCATACAGCCGG - Intronic
1112798825 13:103088077-103088099 CACAAGATTCTGCCTCCACAAGG - Intergenic
1112813541 13:103247014-103247036 CTCAAGAGCCTGCCACAACCTGG - Intergenic
1121162014 14:91752231-91752253 CACCAGACCCTGCCTCCAACAGG + Intronic
1122060948 14:99136379-99136401 CACAAGAGCCCCCATCTTCCAGG + Intergenic
1122093298 14:99353906-99353928 CAGCAGATGCTGCATCCACCAGG - Intergenic
1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG + Exonic
1125422670 15:39520267-39520289 CACAAGAGCCCCCAAACACCTGG + Intergenic
1126455723 15:48859956-48859978 CACTAGAGCCTGCAACCCCTGGG - Intronic
1128869074 15:71138618-71138640 CACAAGAGCCTCCCTCTCCCTGG + Intronic
1130264511 15:82388133-82388155 CACAATTTCCTGTATCCACCAGG - Intergenic
1131111555 15:89767791-89767813 CACAGGCCCCTGCAGCCACCTGG - Intronic
1131821477 15:96278606-96278628 AACAAGAGCCTCCTTCCACTAGG + Intergenic
1133579362 16:7128433-7128455 CAAGAGAGCCTGAATCCTCCAGG + Intronic
1134445509 16:14328163-14328185 CACAAGATACTGCATTCTCCTGG - Intergenic
1138568348 16:57850549-57850571 CACTAAAACCTCCATCCACCAGG + Intronic
1139558086 16:67725274-67725296 CCCAAGAACCTGCCTCCACAAGG + Exonic
1140199072 16:72879840-72879862 CACAAGAACCTTCCTCCACGTGG + Intronic
1140789991 16:78382378-78382400 CAACAGAGGCTCCATCCACCTGG + Intronic
1140959706 16:79900154-79900176 CAACAGAGCCTGCACCCACCAGG + Intergenic
1141051449 16:80768491-80768513 CACCAGACCCTGAATCCACTGGG - Intronic
1141762428 16:86037648-86037670 CTCAATACCCTGAATCCACCAGG - Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142849745 17:2698630-2698652 CACAAGAGCCTGCATCCACCTGG + Intronic
1144458822 17:15440856-15440878 AACTTGAGGCTGCATCCACCTGG + Intronic
1144554263 17:16267894-16267916 GAGCAGAGCCTGCCTCCACCAGG - Intronic
1148097950 17:45066999-45067021 CATAAGCTCCTGCATCCAGCTGG + Intronic
1152066374 17:78114863-78114885 CACCACAGCCAGCATCCGCCTGG + Intronic
1157871633 18:51234917-51234939 CCCAAGACACTGCATCCAACCGG + Intergenic
1159746867 18:72247267-72247289 CACCAGAGCCTGCATCTCCCTGG - Intergenic
1160281972 18:77499353-77499375 CACCAGAGCCAGGAACCACCAGG - Intergenic
1160398039 18:78586304-78586326 CAGAGGAGCCTGCAGGCACCAGG + Intergenic
1162688086 19:12404784-12404806 ATCAAAAGCCTGCAACCACCTGG + Intronic
1163194153 19:15702816-15702838 CACTATTGCCTGCATCCATCTGG + Intergenic
1164977356 19:32583239-32583261 TACAAAAGCTTGCATGCACCTGG - Intronic
1165700389 19:37932936-37932958 CACAGAAGTCTGCATCCAGCAGG - Intronic
1165745175 19:38226372-38226394 CACAAACGCCCTCATCCACCAGG + Intronic
1166068751 19:40375711-40375733 CACAAGTGCCATCATCCACCTGG - Intronic
1166751647 19:45166722-45166744 CTCAGGAGCCTGCAGTCACCAGG + Intronic
1168292216 19:55362254-55362276 CCGAAGCGCCTGCCTCCACCTGG - Exonic
925041353 2:733701-733723 CACAGGACCCTGCAGCCACACGG + Intergenic
925461572 2:4067658-4067680 CACAGGAGCCAGCACCCACATGG - Intergenic
926324264 2:11770834-11770856 CCCAAGAACCTGCCTGCACCAGG - Intronic
926679150 2:15650805-15650827 CACAAGTGCCGGCATCTCCCAGG - Intergenic
928723139 2:34142830-34142852 CCGCTGAGCCTGCATCCACCCGG + Intergenic
929114502 2:38432900-38432922 CCCAAGGGCCTGCACCCGCCTGG - Intergenic
929546041 2:42855771-42855793 CACAAAGGCCCGCATCCACTGGG + Intergenic
932890093 2:75587086-75587108 AACTAGAGCATGCATCCACCTGG + Intergenic
933907728 2:86912197-86912219 CAAAAGATCCTCCATCAACCTGG - Intronic
933908976 2:86921912-86921934 CAAAAGATCCTCCATCAACCTGG - Intronic
934023748 2:87981473-87981495 CAAAAGATCCTCCATCAACCTGG + Intergenic
936095740 2:109529106-109529128 CCCAGCAGCCTGCAGCCACCGGG - Intergenic
936958123 2:118043855-118043877 CACAGGAGACAGCATCCACTAGG - Intergenic
937100762 2:119266209-119266231 CCCATGAGCCTGCATTCCCCTGG + Intergenic
937114271 2:119393082-119393104 CACAACTGCCTGCTTCCTCCTGG + Intergenic
939914239 2:148020614-148020636 CATAAAAGCCTGCATTTACCAGG + Exonic
943414676 2:187586875-187586897 AACAAGAGGCTACAACCACCAGG + Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
944252226 2:197589980-197590002 CACAATAGCCTCCATCTCCCAGG + Intronic
946864425 2:224030192-224030214 CACAAGAGCCTGAAGCCTGCGGG + Intronic
948725577 2:239931752-239931774 CCCAAGAGCCTCCATCCCTCTGG + Intronic
948871020 2:240798129-240798151 CACCAGCGCCTGCATCCACAGGG - Intronic
1170308962 20:14971917-14971939 CACAACTGCCGGCATTCACCCGG + Intronic
1171492797 20:25532985-25533007 CACAGAAGACTGCATTCACCTGG + Intronic
1174444266 20:50580004-50580026 AACAGGAGGCTGCATCCACAGGG - Intronic
1175269525 20:57723999-57724021 CAGAGGAGCCAGCAGCCACCAGG - Intergenic
1175816642 20:61886517-61886539 GACAGGAGCATGCATCCAGCAGG + Intronic
1176665110 21:9679083-9679105 CCCCTGAGCCTGCACCCACCCGG + Intergenic
1178678324 21:34649653-34649675 GAAAAGAGGCTGCATTCACCTGG + Intergenic
1183353160 22:37344663-37344685 CACAAGAGACTCCATGCACGTGG + Intergenic
1183463060 22:37964353-37964375 CACAACTGCCTGCCTCCACCTGG - Intronic
1183469822 22:37999300-37999322 CAAAGGTGCCTGCAGCCACCCGG - Intronic
1183866165 22:40705929-40705951 CACAAGAGCTTCCATCCCCTTGG + Intergenic
1185206224 22:49540764-49540786 CACTGGAGCCGGCTTCCACCAGG - Intronic
949193385 3:1276881-1276903 CAAAAGAGCCACCATTCACCCGG - Intronic
950441099 3:13010953-13010975 CACTAGAGCTTGCCTCCTCCTGG + Intronic
951191336 3:19775050-19775072 AAGGAGAGCCTGCATCTACCTGG - Intergenic
953648046 3:44773485-44773507 CGCATGAGCCTGCAGCCACTGGG + Intronic
958993375 3:100873520-100873542 ATCAAGAGCATGCATCCACTGGG - Intronic
960963689 3:123090129-123090151 CAGACGTGCCTGCATCCTCCAGG + Intronic
962990013 3:140569305-140569327 GACATGAGCCTGCATCTGCCTGG - Exonic
965163059 3:165160058-165160080 CAGAAGAGATTCCATCCACCTGG - Intergenic
965659740 3:171028814-171028836 CACCAGTGCCTGCAATCACCCGG + Intergenic
968289195 3:197525741-197525763 CACCAGAGTCTGCAGCCAGCAGG - Intronic
968552639 4:1231527-1231549 CCCAAGAGCCAGCTGCCACCAGG - Intronic
969718188 4:8878440-8878462 CACCAGAGCATCCATCCTCCAGG - Intergenic
980179657 4:129388377-129388399 CACAAGCCCAAGCATCCACCAGG - Intergenic
984270493 4:177543100-177543122 CACAAGAGAATGCATCCAAGGGG - Intergenic
985410590 4:189679551-189679573 CTCCTGAGCCTGCACCCACCCGG + Intergenic
985772840 5:1824016-1824038 CACAGCAGCCTCCACCCACCGGG + Intergenic
985789372 5:1916929-1916951 CACAAGAGCTGGTGTCCACCCGG - Intergenic
994552061 5:101247539-101247561 CACCAGACACTGGATCCACCAGG + Intergenic
994552068 5:101247573-101247595 CACAAGACACTGGATCCACCAGG + Intergenic
996912452 5:128670691-128670713 CCCAGGAGCCTGCCTCCCCCAGG - Intronic
1001670634 5:173470470-173470492 CACAACATCCTGGATCCACCAGG - Intergenic
1002429651 5:179195637-179195659 CCCAACAGCCTTCAGCCACCTGG + Intronic
1005847995 6:29797353-29797375 CACAACAGCCAGCTTCCCCCAGG - Intergenic
1011596747 6:89023952-89023974 CTCAGGAGGCTGCATCCAGCTGG + Intergenic
1018868190 6:167761329-167761351 GCCAAGAGCCGGCATCCACATGG + Intergenic
1019358647 7:593938-593960 CACAAGAGCCGGCATCGCCGTGG + Intronic
1019915475 7:4129537-4129559 CACAGGAGCCAGCAGCCCCCTGG - Intronic
1021334060 7:19376445-19376467 CACTAGAGGCTGCATCTCCCAGG + Intergenic
1024056197 7:45661127-45661149 CCCAGGGGCCTGCATCCACTGGG - Intronic
1025238431 7:57251081-57251103 CATAAGAGCTGGCTTCCACCTGG - Intergenic
1025257963 7:57398510-57398532 CAAGAGAGGCTGCATCCAACAGG + Intergenic
1026627130 7:72005171-72005193 CACAAAAGCCTGCATACAAATGG + Intronic
1026889645 7:73974453-73974475 TGCAAGAGCAAGCATCCACCAGG + Intergenic
1027624430 7:80528952-80528974 GACATGAGCCTGAATCCACAGGG - Intronic
1028696225 7:93716356-93716378 CACAAGAGCTTGCATATAGCTGG - Intronic
1033719930 7:144048658-144048680 AACAAGAGCATGCATTCTCCAGG - Intergenic
1034502927 7:151462635-151462657 CACAAGAGCCTGCAGGCTCCAGG + Intergenic
1034522391 7:151631106-151631128 CACAAGGGACAGCATCCACATGG + Intronic
1035355281 7:158272916-158272938 CAGCAGAGTCTGCATGCACCGGG - Intronic
1040934078 8:52765208-52765230 CAGTAGGGACTGCATCCACCTGG + Intergenic
1045945309 8:107788852-107788874 CACAAGAGCCCCCATACAGCTGG - Intergenic
1047180701 8:122585029-122585051 CACAACAGGCTGCAGCCAGCAGG - Intergenic
1050527663 9:6560099-6560121 TACAAGAGCCTGTGTCCACATGG - Intronic
1050656777 9:7837219-7837241 CACTAGATCCTGGTTCCACCTGG - Intronic
1053503769 9:38622368-38622390 CACAAGGAGCTGCATCCAGCAGG - Intergenic
1055058164 9:72042486-72042508 CACAAGAGCCTCACTCCCCCTGG + Intergenic
1056113994 9:83424128-83424150 CACGACCGTCTGCATCCACCTGG - Intronic
1057378610 9:94547152-94547174 CACTACAGCCTCCATCCACTGGG + Intergenic
1058275666 9:103038256-103038278 CACAAGACCCAGCCCCCACCCGG + Intergenic
1058674287 9:107387549-107387571 GGCAAGATCCTGCAGCCACCTGG + Intergenic
1060527687 9:124329692-124329714 ACCAAGGGCCTGCACCCACCAGG + Intronic
1062154550 9:135039410-135039432 CACTCGTGCATGCATCCACCTGG - Intergenic
1062623065 9:137431254-137431276 CCCAAGAGCTGGCACCCACCAGG + Exonic
1203660991 Un_KI270753v1:42666-42688 CCCCTGAGCCTGCACCCACCCGG - Intergenic
1203672172 Un_KI270755v1:25875-25897 CTCCTGAGCCTGCACCCACCCGG - Intergenic
1185923496 X:4120618-4120640 CTCAAGAGCCTGCAATCATCTGG - Intergenic
1185930651 X:4199557-4199579 GTCATGAGTCTGCATCCACCTGG + Intergenic
1187968652 X:24638000-24638022 CACAGAAGCCTGCATGTACCAGG + Intronic
1188607421 X:32049188-32049210 GACAACAGCATGCATCCACTTGG + Intronic
1192849774 X:74942624-74942646 AGCAGGAGGCTGCATCCACCAGG + Intergenic
1193247895 X:79251582-79251604 CACAGGTGCCTGTATCCACTGGG + Intergenic
1195059219 X:101177678-101177700 CACATCAGTCTGCCTCCACCAGG - Intergenic
1201711149 Y:16993796-16993818 GTCATGAGTCTGCATCCACCTGG + Intergenic