ID: 1142853477

View in Genome Browser
Species Human (GRCh38)
Location 17:2716782-2716804
Sequence CTGCATAAAGATAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142853471_1142853477 -7 Left 1142853471 17:2716766-2716788 CCTATCTTTTGGGTCCCTGCATA No data
Right 1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG No data
1142853468_1142853477 11 Left 1142853468 17:2716748-2716770 CCTGAGCACTGCAGTTTTCCTAT No data
Right 1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG No data
1142853467_1142853477 23 Left 1142853467 17:2716736-2716758 CCTCATGGCACTCCTGAGCACTG No data
Right 1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142853477 Original CRISPR CTGCATAAAGATAAGGAGGA GGG Intergenic
No off target data available for this crispr