ID: 1142854422

View in Genome Browser
Species Human (GRCh38)
Location 17:2721957-2721979
Sequence CTGGATGCCCAGGAGGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 466}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142854409_1142854422 10 Left 1142854409 17:2721924-2721946 CCAGAGTGCGGTGGGGGCCCCTA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1142854422 17:2721957-2721979 CTGGATGCCCAGGAGGGAAGGGG 0: 1
1: 0
2: 3
3: 58
4: 466
1142854412_1142854422 -7 Left 1142854412 17:2721941-2721963 CCCCTAGCTGGACACCCTGGATG 0: 1
1: 0
2: 1
3: 12
4: 85
Right 1142854422 17:2721957-2721979 CTGGATGCCCAGGAGGGAAGGGG 0: 1
1: 0
2: 3
3: 58
4: 466
1142854406_1142854422 17 Left 1142854406 17:2721917-2721939 CCTGGGACCAGAGTGCGGTGGGG 0: 1
1: 0
2: 1
3: 24
4: 288
Right 1142854422 17:2721957-2721979 CTGGATGCCCAGGAGGGAAGGGG 0: 1
1: 0
2: 3
3: 58
4: 466
1142854414_1142854422 -9 Left 1142854414 17:2721943-2721965 CCTAGCTGGACACCCTGGATGCC 0: 1
1: 0
2: 1
3: 21
4: 152
Right 1142854422 17:2721957-2721979 CTGGATGCCCAGGAGGGAAGGGG 0: 1
1: 0
2: 3
3: 58
4: 466
1142854413_1142854422 -8 Left 1142854413 17:2721942-2721964 CCCTAGCTGGACACCCTGGATGC 0: 1
1: 0
2: 1
3: 6
4: 111
Right 1142854422 17:2721957-2721979 CTGGATGCCCAGGAGGGAAGGGG 0: 1
1: 0
2: 3
3: 58
4: 466
1142854404_1142854422 18 Left 1142854404 17:2721916-2721938 CCCTGGGACCAGAGTGCGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1142854422 17:2721957-2721979 CTGGATGCCCAGGAGGGAAGGGG 0: 1
1: 0
2: 3
3: 58
4: 466
1142854401_1142854422 30 Left 1142854401 17:2721904-2721926 CCACTGGAAGATCCCTGGGACCA 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1142854422 17:2721957-2721979 CTGGATGCCCAGGAGGGAAGGGG 0: 1
1: 0
2: 3
3: 58
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142854422 Original CRISPR CTGGATGCCCAGGAGGGAAG GGG Intergenic
900391115 1:2434369-2434391 GTGGGTGCCCGGGAGAGAAGGGG - Intronic
900483366 1:2910055-2910077 CAGGAGGCCCATGAGTGAAGGGG + Intergenic
900557474 1:3287650-3287672 CTGGATGCCCACGTGGCAGGGGG - Intronic
900557514 1:3287794-3287816 CTGGATGCCCACGTGGCAGGGGG - Intronic
900744829 1:4353937-4353959 CTGAATGGCCAGTAGGGATGTGG + Intergenic
900774714 1:4573904-4573926 CTGGCTGTCCAGGAGGGACCTGG - Intergenic
900790204 1:4675023-4675045 CATGAAGCCCAGGAGGGCAGTGG + Intronic
901017546 1:6240729-6240751 CTGGAAGTACAGAAGGGAAGGGG + Intergenic
901455406 1:9360245-9360267 CTGGATGCCAAGTGAGGAAGGGG + Intronic
901678157 1:10898710-10898732 CTGGTTGGCCAGCTGGGAAGGGG - Intergenic
901951833 1:12755615-12755637 CTGATGGCCCAGGAGGTAAGGGG + Intronic
902374251 1:16022852-16022874 CTGGGTGGCAGGGAGGGAAGGGG + Intronic
902379202 1:16044729-16044751 CTGGGTGGCAGGGAGGGAAGGGG + Intronic
903533684 1:24052251-24052273 CTGGAGGCCCAGGTGAAAAGAGG + Intergenic
903584437 1:24400614-24400636 CTGGAAGCCCACCAGGGAGGTGG + Intronic
903909111 1:26709336-26709358 GTGGATGCACAGGAGGAAGGTGG - Intronic
904488606 1:30844283-30844305 CTTTGTGGCCAGGAGGGAAGGGG - Intergenic
904585431 1:31577206-31577228 CTGGGTGCCCAGCAGGGTCGTGG + Exonic
904693279 1:32311073-32311095 GTGGTAGCCCAGGATGGAAGTGG + Intronic
904965467 1:34369271-34369293 CAGGTTGCCCAGGAGTCAAGTGG + Intergenic
905633170 1:39530360-39530382 CATGAAGCCCAGGAGAGAAGAGG - Intergenic
905641000 1:39589772-39589794 AGGGATGCTCAGGAGAGAAGGGG + Intergenic
906061760 1:42953556-42953578 CTTTATGCCCAGGAGTGAGGTGG + Intronic
906073636 1:43035941-43035963 ATGGAGGCCCAGGTGGGCAGAGG + Intergenic
906523102 1:46478842-46478864 GTGGATTCCCAGGAGAGAGGTGG - Intergenic
909283653 1:73788676-73788698 CTGGGACCCCAGGAGGGAAGTGG - Intergenic
910763618 1:90759100-90759122 CAGAATGCCCAGGAAGGAGGAGG - Intergenic
910803164 1:91165163-91165185 GTGGACATCCAGGAGGGAAGAGG + Intergenic
911384218 1:97154669-97154691 TTTGTTGCCCAGGAGGGCAGTGG - Intronic
911534954 1:99089213-99089235 CTGGAGGCCTAGGAGGAAAAAGG + Intergenic
911840935 1:102680946-102680968 CTGGAAGCCTAGGAGGGGAAAGG + Intergenic
912200627 1:107453662-107453684 GTGGATGCCATGTAGGGAAGTGG + Intronic
912456500 1:109801963-109801985 CTGGCAGCCCAGGGGGGAGGGGG + Intergenic
912794175 1:112681091-112681113 TTGGATGCCCATAAGGGGAGGGG - Intronic
912953989 1:114139853-114139875 CTGGATGCCCTGGAGGAACAAGG - Exonic
915041002 1:152968223-152968245 CTGGCTTCCAAGGAGGGAATCGG + Intergenic
915142733 1:153777182-153777204 CACGATGCCCAGCAGGGAACCGG - Exonic
915317096 1:155034785-155034807 CTGCATGCCCAGGAAGGAGTCGG + Intronic
915357019 1:155261552-155261574 CTGCATGCACAGGAAGGAAGAGG - Intronic
916055721 1:161068026-161068048 CTGGATTCCTAGCAGGGAAGGGG - Intronic
917653989 1:177107553-177107575 CTGGGTTCCCAGGAGAGCAGAGG + Intronic
919554339 1:199031860-199031882 CTGGAGGCCGAGGAGGAAAGTGG - Intergenic
920389552 1:205590667-205590689 CTGCATGCCCAGAAGTGGAGGGG + Intronic
920542420 1:206789341-206789363 CTGGATCCTCAGAAGGGCAGGGG - Intergenic
920714366 1:208325853-208325875 CTGGGTGCCCAGGTGAGAAAAGG - Intergenic
921523073 1:216181365-216181387 CTGGCTTCCCAGGAGCAAAGGGG - Intronic
921572521 1:216796265-216796287 CTGGGAGCCCAGTGGGGAAGTGG - Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922024976 1:221741639-221741661 CTGTGTGCCGAGGAGTGAAGCGG - Intronic
922461459 1:225817167-225817189 CTGGAGACTCAGGATGGAAGAGG - Intronic
922668719 1:227493320-227493342 TTGCATGCCCATGAGGGAGGTGG - Intergenic
922670877 1:227507979-227508001 TTGCATGCCCATGAGGGAGGTGG + Intergenic
923634584 1:235682318-235682340 CTGTATGCCCAAGAAGAAAGTGG + Intronic
923855104 1:237837870-237837892 CTGGAGGCCCAGGAAGCAGGTGG + Intergenic
924235685 1:241998060-241998082 CTTGTTGCCCAGGAGTGCAGTGG + Intronic
924707287 1:246510859-246510881 CGGGCAGCCCAGGAGGGCAGAGG - Intergenic
1062906617 10:1183848-1183870 CAGGGAGGCCAGGAGGGAAGAGG + Intronic
1062986365 10:1772879-1772901 CTGGGTGCCCTGGAGAGAAAGGG + Intergenic
1064476639 10:15697418-15697440 CTGGACGGGGAGGAGGGAAGAGG - Intronic
1066053385 10:31658589-31658611 CTGGCTGCCCAACAGGAAAGGGG + Intergenic
1066135052 10:32437487-32437509 GAGGATGCCCAGGAGGCAAGTGG + Intergenic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1067077283 10:43195335-43195357 CTGCCTACCCAGGTGGGAAGAGG + Exonic
1067686204 10:48467096-48467118 TAGGATGCCCAGGCAGGAAGAGG - Intronic
1067763986 10:49071454-49071476 CTTGAGGCTCAGGAGGGAAGGGG + Intronic
1067811868 10:49434727-49434749 CTTGTTGCCCAGGAGTGCAGTGG - Intergenic
1068117593 10:52751631-52751653 TTGGAAGCCCAGGATTGAAGTGG + Intergenic
1068855553 10:61794258-61794280 CCAGCTGCCCAGGAGTGAAGTGG + Intergenic
1069636916 10:69930497-69930519 CAGGGAGCCCAGGAGAGAAGGGG + Exonic
1070112800 10:73500764-73500786 ATGGATGACAGGGAGGGAAGAGG + Exonic
1070590534 10:77797559-77797581 GGGCAGGCCCAGGAGGGAAGTGG + Intronic
1070611592 10:77937118-77937140 CTGGATGCCCTGCAGGCAATGGG - Intergenic
1072158184 10:92742900-92742922 CTGGATGTCCAGTAGGGGATGGG + Intergenic
1072699927 10:97633319-97633341 CTGGAGGCGCAGGAGGGAGGGGG - Intronic
1072899236 10:99392816-99392838 CTACATGCCCAGGAGAGATGGGG - Exonic
1072987136 10:100150901-100150923 CTGGCTGCCCAGGACGTCAGTGG + Exonic
1073583317 10:104686688-104686710 TTTGATGACAAGGAGGGAAGAGG - Intronic
1075089653 10:119436575-119436597 CAGGATCCTGAGGAGGGAAGTGG + Intronic
1075964325 10:126598027-126598049 CTGGATGCCCACGAGGCATTTGG - Intronic
1076363764 10:129909193-129909215 ATGGCTGCCCTGGATGGAAGAGG + Intronic
1076403912 10:130200316-130200338 CTGGGGGCTCAGGAGGGGAGGGG - Intergenic
1076473183 10:130734450-130734472 CTGGACGGCAAGGAGGGAAAAGG + Intergenic
1076529485 10:131135087-131135109 GTGGTTCTCCAGGAGGGAAGAGG + Intronic
1076546815 10:131250970-131250992 CTAGAAGCACAGGTGGGAAGCGG - Intronic
1076821002 10:132939537-132939559 CTCAATGCCCAGGTGGGAGGAGG + Intronic
1076849749 10:133087058-133087080 GTGGAGGCCAAGGAGGGAACAGG + Intronic
1078249196 11:9603194-9603216 CTTGTTGCCCTGGAGGGCAGTGG + Intergenic
1078443602 11:11387412-11387434 CCAGTTGCCCAGGAGGGGAGTGG + Intronic
1078516011 11:12023189-12023211 CTGGAGGCCTAGGAGGGAAATGG + Intergenic
1078763536 11:14271880-14271902 CTGGATGACCAGGAAGGTGGTGG - Intergenic
1080240575 11:30122657-30122679 TTTCATGCCCAGAAGGGAAGAGG + Intergenic
1080478841 11:32624461-32624483 AAGGATGCCCAATAGGGAAGTGG + Intronic
1081200605 11:40210623-40210645 CTGGAGTCCCAGGATGGAAAGGG - Intronic
1081426369 11:42930536-42930558 TTTGATGCCCAGAAGGGAAGGGG + Intergenic
1082270652 11:50166498-50166520 TTGGAAGCCTAGGAGGGAAAAGG + Intergenic
1083295416 11:61712722-61712744 CTGAAAGCACAGGAGGGGAGAGG - Intronic
1083308509 11:61772809-61772831 GTGGAGCTCCAGGAGGGAAGAGG + Intronic
1084412927 11:69014427-69014449 CTGGCTGCCCTGGAGAGGAGGGG - Intergenic
1084502907 11:69545458-69545480 CTGGAGGCTCAGGAGAGGAGGGG - Intergenic
1084598573 11:70131734-70131756 CTGGATGGCAAGGAGGGACAGGG + Intronic
1085792867 11:79510981-79511003 CTTGATGCTGAAGAGGGAAGCGG + Intergenic
1086180598 11:83946411-83946433 CTGGATGTCCAGGGTGGAAGTGG - Intronic
1087847706 11:102992021-102992043 CGGAATGCCCAGGAGGAAATGGG + Intergenic
1088905421 11:114151780-114151802 CTGGCTGCATAGGATGGAAGTGG + Intronic
1089160768 11:116435337-116435359 CTGGGTGCTCTGGAGAGAAGGGG + Intergenic
1089205488 11:116758269-116758291 CTGTATGCCCAGTGGGGAAAAGG - Exonic
1090395260 11:126414465-126414487 CTGGCCTCCCAGGAGGGCAGGGG + Exonic
1091280020 11:134376422-134376444 CTGGACCCCCAGGCGGCAAGTGG - Intronic
1091488819 12:915524-915546 CTGGATGGGCAGGAGAGAACAGG + Intronic
1091889886 12:4045041-4045063 CTGGAAGACCAGGAGGAAGGGGG + Intergenic
1091988944 12:4938800-4938822 CTGGATGTGGAGGTGGGAAGGGG + Intergenic
1093759900 12:22897467-22897489 CTTGATGTCCAGGATTGAAGGGG + Intergenic
1094050939 12:26220017-26220039 CTGGCTTCCCAGCAGGGAAGGGG - Intronic
1095623172 12:44282854-44282876 CCGGAAGCCCAGGAGGAAAGTGG + Intronic
1096111563 12:49031934-49031956 CAGGAGGCCCTGGAGGGGAGAGG + Exonic
1096543945 12:52324143-52324165 CCTGGAGCCCAGGAGGGAAGAGG - Intergenic
1096694380 12:53339214-53339236 ATGGATGCCCCAGACGGAAGGGG + Intronic
1097226490 12:57479443-57479465 CTGGAGACCCAGAAGGGAATAGG + Intronic
1097885161 12:64721587-64721609 TTTGATGACCAGGAGGTAAGAGG - Exonic
1099198073 12:79642510-79642532 CTGCAAGCCAAGGAGGCAAGAGG - Intronic
1099572509 12:84341750-84341772 TTGGATGCCCAGGAAGTAAAAGG - Intergenic
1100085851 12:90909544-90909566 CTGGATGCCCAGGAGCTGTGTGG + Intronic
1102199025 12:111044731-111044753 CTGAATCCACAGGAGGGATGAGG + Intronic
1102719475 12:115003703-115003725 GTGGAGGCCCAGGAGGAGAGTGG - Intergenic
1103161197 12:118730715-118730737 CTGAGTGCCCAGGTGGGATGAGG + Intergenic
1103951576 12:124554384-124554406 CTGGATGCCCAGCTGGGTGGTGG - Intronic
1104961646 12:132490847-132490869 CTGGAGGCCCTGGAGGTAGGTGG + Exonic
1105702570 13:22944224-22944246 CTGGAAGCCCAGTAGGGAAAGGG - Intergenic
1105855194 13:24366007-24366029 CTGGAAGCCCAGCCGGGAAAGGG - Intergenic
1107039489 13:35933732-35933754 CTGGAGGCCTAGGAGGAAAAAGG - Intronic
1108000370 13:45900585-45900607 CTAGATGTCCAGGAGCAAAGAGG + Intergenic
1108677118 13:52746630-52746652 ATGGATTCCCAGGAGACAAGGGG - Intergenic
1110284420 13:73732912-73732934 CTGGACTGCCAGGAGAGAAGTGG - Intronic
1111399628 13:87717484-87717506 CTGAGTGCCTAGGAGGGTAGTGG - Intergenic
1112200499 13:97269478-97269500 CTGGATGAGCAGGGAGGAAGGGG - Intronic
1112421335 13:99252114-99252136 CTGGATGACCAGTTGGGAAGTGG - Intronic
1113836154 13:113329921-113329943 CTGGGCGCCCAGGTGGGCAGGGG + Intronic
1114043330 14:18700186-18700208 CTGGATGGACAGGTGGGATGCGG - Intergenic
1114635762 14:24185952-24185974 CTAGATGCCCATGTTGGAAGAGG - Exonic
1116281543 14:42914774-42914796 CTGGATGCCCAGGCAGAAATTGG - Intergenic
1117223118 14:53627196-53627218 ATGGCTACCAAGGAGGGAAGGGG + Intergenic
1117918690 14:60705278-60705300 CTTGATACCCAGTAGGGAAGTGG + Intergenic
1117963495 14:61184972-61184994 CTGCATGCCCATGAGGGAATGGG - Intergenic
1118177851 14:63460364-63460386 CTTGCTGCGGAGGAGGGAAGGGG + Intronic
1118747738 14:68786076-68786098 CTGGAGGCCCTGGAGGGTGGGGG - Intergenic
1118907855 14:70035892-70035914 CTGGATGACCAGGAGTCCAGTGG + Intergenic
1119703118 14:76768495-76768517 GTGGAGACGCAGGAGGGAAGGGG - Intronic
1120635900 14:86950536-86950558 GTGGCTGGCTAGGAGGGAAGGGG + Intergenic
1121112849 14:91324231-91324253 GAGCAAGCCCAGGAGGGAAGAGG + Intronic
1121446195 14:93980763-93980785 CTGAATGCCCAGGAATAAAGGGG + Intergenic
1122072375 14:99213039-99213061 CAGGATGCCCACCAGGGGAGAGG + Intronic
1122159630 14:99773869-99773891 CTTAATGGCCACGAGGGAAGTGG + Intronic
1122268903 14:100559487-100559509 CCTGGTGCCCAGGAGAGAAGAGG + Intronic
1122287903 14:100663175-100663197 CGGGAGGCCCAGGAGAGAAAAGG + Intergenic
1122592887 14:102868077-102868099 CAGGATGCCCAGGAGCTCAGGGG + Intronic
1122603450 14:102932516-102932538 CAGAAGGCCCAGGAGGGCAGTGG + Exonic
1122634051 14:103122109-103122131 CTGGAGTCCTAGGAGAGAAGGGG + Intergenic
1122673809 14:103393225-103393247 TGGGAGGCCGAGGAGGGAAGTGG - Intronic
1122792242 14:104188958-104188980 CCGGCAGCCCAGGTGGGAAGTGG - Intergenic
1123028887 14:105441271-105441293 CTGGGAGCCAAGGAGGCAAGAGG - Intronic
1123501871 15:20893665-20893687 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123559124 15:21467364-21467386 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123595355 15:21904645-21904667 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123932082 15:25176796-25176818 CTGGATGCCTAGGCAGGGAGGGG + Intergenic
1123944133 15:25230802-25230824 CTGGATGCGTATGTGGGAAGGGG + Intergenic
1124787714 15:32697661-32697683 GTGGAGGGCCAGGAGGGAATGGG + Intergenic
1125975403 15:43946716-43946738 GTGGGTTCCCAGGATGGAAGGGG + Intronic
1126743945 15:51806329-51806351 CAGGATGACCAAGAAGGAAGAGG - Intronic
1129250610 15:74306917-74306939 ACGGAGGCCCAGGAGGGGAGGGG - Intronic
1129690416 15:77710126-77710148 CTGGAACCCCAGGGGGGCAGGGG + Intronic
1130004817 15:80085063-80085085 CTTGAGGACCAGGAGGAAAGTGG - Intronic
1130033021 15:80332963-80332985 CTGGATGCTCAGCCTGGAAGAGG + Intergenic
1130652165 15:85768332-85768354 CTGGCTGCCCAGGACGGCAGCGG + Exonic
1131368099 15:91856263-91856285 CTGGAGGCCCAGGAGAGGACAGG + Intronic
1131380824 15:91962576-91962598 CTTGGTGCTGAGGAGGGAAGTGG + Intronic
1131671836 15:94627960-94627982 GTGCATGCCCAGGACGGAAAGGG + Intergenic
1132344916 15:101102339-101102361 CCGGATCACCAGGAGGGCAGTGG + Intergenic
1132737412 16:1393797-1393819 TTGGATGCCCAGGAGGCAGGTGG + Intronic
1132988964 16:2783359-2783381 CTGGCTCCCCAGGAGGAAAGGGG + Intergenic
1133023412 16:2976825-2976847 CTGGGGTCCGAGGAGGGAAGAGG + Exonic
1133235700 16:4386445-4386467 CTGGGGGCCCTGCAGGGAAGGGG + Intronic
1134042843 16:11081377-11081399 CTGGGTGCCCAGGACAGAGGAGG - Intronic
1135619444 16:23942980-23943002 CTGGATGCTCCGGAGGGGAGTGG - Intronic
1136499385 16:30662489-30662511 CTGGAGGCACGGGAGGGCAGTGG + Intronic
1136518171 16:30780305-30780327 CTGGATCCCCACCAGGGAGGAGG + Exonic
1137977196 16:53041952-53041974 CTGGAGGAGCAGGAGGGATGGGG - Intergenic
1138099668 16:54242487-54242509 CTGGGTGCCCAGGAGGAAAAGGG + Intergenic
1138202744 16:55102118-55102140 CTGGATCAGCAGGAGGGAAGGGG - Intergenic
1138279565 16:55762436-55762458 CTGGAAGCCCAGGGAGGAAGAGG - Intergenic
1138339148 16:56277252-56277274 CTGGAGGCCAAGTTGGGAAGTGG + Intronic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1139580669 16:67872016-67872038 CTGTATGCTGAGGAAGGAAGTGG - Exonic
1139953200 16:70681698-70681720 CTGTTTCCCCAGGAGGGGAGGGG - Intronic
1139972313 16:70783767-70783789 TCGGATGCCCAGGGGAGAAGGGG + Intronic
1139975676 16:70808136-70808158 CTTGATGTCCAGGAGTGGAGGGG - Intronic
1140091803 16:71845578-71845600 CTGGGTCCCCAAGAGGTAAGAGG + Intergenic
1140530084 16:75658023-75658045 CAGGATGCACTGTAGGGAAGTGG - Intronic
1140942750 16:79737128-79737150 CTTGATGCCCAGGAAGCAATGGG - Intergenic
1141237200 16:82229623-82229645 TTGGATTCCCAGCAGGGAATGGG - Intergenic
1141336800 16:83163545-83163567 CTGTGTGCCCAGGAGGAACGGGG - Intronic
1141533959 16:84666037-84666059 CTGAGTGCCCAGGAGGGGAGGGG + Intronic
1141642817 16:85351185-85351207 CTGGATGCCCAGGAGGGAGAGGG + Intergenic
1141667673 16:85474336-85474358 CAGGATGCGGAGGAGGGCAGAGG - Intergenic
1141824890 16:86472028-86472050 CTGGATGCTCAGGATGGGAGAGG + Intergenic
1141954925 16:87364387-87364409 CTGGATGGCCAGGTGTGCAGTGG + Intronic
1142209547 16:88802317-88802339 CTGGAGGCCTGCGAGGGAAGGGG - Intergenic
1142273704 16:89104640-89104662 CTGGATGCCCTGCAGAGAAGAGG - Intronic
1142841526 17:2635121-2635143 CTTGTTGCCCAGGAGGGCACTGG - Intronic
1142854422 17:2721957-2721979 CTGGATGCCCAGGAGGGAAGGGG + Intergenic
1143996686 17:11012509-11012531 CTGCATTCCCAAGAGGGGAGAGG + Intergenic
1144948332 17:18981158-18981180 CTGAATGCCCAGGATCGCAGAGG + Intronic
1144956289 17:19020481-19020503 CGGGATCCCCATGAGGGAAATGG - Exonic
1145028703 17:19488471-19488493 CTGGTGGGCCAGGAGAGAAGGGG + Intergenic
1145940575 17:28741382-28741404 AAGAATCCCCAGGAGGGAAGTGG - Intronic
1146390244 17:32415536-32415558 CAGGATGGCCAGCAAGGAAGAGG - Intergenic
1146409610 17:32571195-32571217 CAGGGTAGCCAGGAGGGAAGAGG + Intronic
1146638289 17:34521944-34521966 CCGGATGGGCAGGAGGGTAGAGG + Intergenic
1146642222 17:34550105-34550127 CTGGAAGCCGAGGAGGAAGGAGG + Intergenic
1146652259 17:34614016-34614038 CAGGATGACCACGAGGGAAGGGG - Intronic
1146874833 17:36400950-36400972 CTGGATGGACAGGAGGGACGCGG + Intronic
1147064554 17:37911929-37911951 CTGGATGGACAGGAGGGACGTGG - Intergenic
1147995215 17:44356402-44356424 CTGGGTGCCCAGCACGGATGGGG - Intronic
1148325609 17:46781898-46781920 CTGGCTGCCCAGGAGGTGGGAGG + Intronic
1148437293 17:47694306-47694328 CGGGATGGCTGGGAGGGAAGGGG + Intronic
1148748617 17:49932013-49932035 CTGAGAGCCCAGGAGAGAAGTGG + Intergenic
1148862198 17:50610211-50610233 GAGGAGGCACAGGAGGGAAGAGG - Intronic
1150611887 17:66739821-66739843 CTGGCTGTGGAGGAGGGAAGAGG + Intronic
1151004599 17:70419765-70419787 GTGGATGCCTAGAAGGAAAGTGG - Intergenic
1151190641 17:72395400-72395422 CTCTATGCCCAGATGGGAAGAGG - Intergenic
1151402316 17:73863891-73863913 CTGGGGGTGCAGGAGGGAAGAGG - Intergenic
1151997253 17:77617921-77617943 CAGGAAGCTCAGGAGGGAGGTGG - Intergenic
1152423575 17:80206974-80206996 CTGGACGTCCAGGAGGGCATGGG - Exonic
1152486858 17:80600194-80600216 CTGGGAGCCCAGGAGGTAAAGGG + Intronic
1152528715 17:80904273-80904295 CTGGTTCCCCAGGATGGCAGAGG + Intronic
1153188787 18:2515614-2515636 TTAGATGCCCAGAAAGGAAGAGG + Intergenic
1154266674 18:12884387-12884409 CGGGGTGCCCAGGTGGGAGGGGG + Intronic
1155387755 18:25299028-25299050 CTGGATTTCCACGTGGGAAGTGG - Intronic
1155625482 18:27829557-27829579 CTGGTTGAGAAGGAGGGAAGAGG + Intergenic
1156185367 18:34656497-34656519 CTGGAAGTTCAGAAGGGAAGGGG - Intronic
1156775310 18:40780473-40780495 CTGTATGCTGAGGAGGAAAGAGG + Intergenic
1157445906 18:47746990-47747012 GTGGATCCCCATGAGGCAAGAGG + Intergenic
1157482175 18:48062281-48062303 CTTGATCCCCAGAAGGGGAGAGG + Intronic
1159941653 18:74413061-74413083 CTGGACCCCCAGGAGGGCAGTGG + Intergenic
1160793521 19:933600-933622 CTGGAAGCCCAGGGCCGAAGGGG - Intronic
1160841098 19:1147384-1147406 CTGGCTGCCGAGGAAGGAGGCGG + Exonic
1160894876 19:1397643-1397665 CTGGAAGCCCAGGTGTGAACGGG + Intronic
1161318698 19:3631321-3631343 CTGGATGGCCAGCAGGGACAGGG - Exonic
1161585280 19:5102361-5102383 CTGGCTGCCCAGGAGGGATGTGG + Intronic
1161723332 19:5915394-5915416 GTGGCTGCCCAGGAGAGAAGGGG - Exonic
1162060178 19:8090098-8090120 CTGTGTCCCCAGGAGGGCAGCGG - Exonic
1163807188 19:19406278-19406300 CAGGAAGCGCAGGACGGAAGCGG - Intronic
1163832680 19:19554551-19554573 CTGGCGGCCCAGTAGAGAAGGGG + Intergenic
1164388226 19:27794684-27794706 CTTGATGCTCTGGAGGGAAACGG - Intergenic
1164683363 19:30150598-30150620 CGGGGTGCTGAGGAGGGAAGTGG + Intergenic
1164869409 19:31630670-31630692 CTGGATGGCCAGGAGTCAGGAGG + Intergenic
1165474804 19:36024388-36024410 CTGGATGGCCAGAAGGTCAGGGG - Exonic
1165739559 19:38197297-38197319 CTTGAAGCCCCTGAGGGAAGGGG - Intronic
1165893755 19:39129750-39129772 CTGGATGCCCAAGGGGGTAAAGG - Intronic
1166244752 19:41517509-41517531 CTTGATATCCAGGAGGGGAGAGG - Intergenic
1166350854 19:42197445-42197467 CTTGATGTGCAGGAGGGGAGTGG - Intergenic
1167141124 19:47651423-47651445 CAGGATGTGCAGGAGGTAAGGGG - Intronic
1167154183 19:47728322-47728344 GTGGATGGCCAGGTGGGAGGGGG - Intronic
1167520293 19:49950791-49950813 GTGGATGCCCAGGAAGGAGGAGG + Intronic
1167979678 19:53263165-53263187 CCAGAGGCCCAGGAGGGAAGGGG - Intergenic
1168102254 19:54147487-54147509 AGCGATGCCCAGGAGAGAAGTGG + Intronic
1168422151 19:56211468-56211490 CTGGATGGGGAGGAAGGAAGAGG - Intergenic
925405912 2:3605413-3605435 GTGGGTGCCGAGGAGGGGAGGGG + Intronic
925405922 2:3605442-3605464 GTGGGTGCCGAGGAGGGGAGGGG + Intronic
926243034 2:11102591-11102613 CTGGATGCCACAGAGGCAAGAGG + Intergenic
926489180 2:13502908-13502930 CTGGATGGTCAGGAGGGGGGTGG - Intergenic
926816743 2:16805052-16805074 CTGGAGGCCTAGGAGGAAAATGG - Intergenic
928127892 2:28628743-28628765 CTGGATGGCAGGGAGGGAGGTGG + Intronic
929562047 2:42962125-42962147 ATGGATGCCCTGGAGGGAGGAGG - Intergenic
929888073 2:45896005-45896027 CTGGATGCGCAGGAGTGGGGTGG + Intronic
930108530 2:47658555-47658577 GGGGATTCCCAGAAGGGAAGGGG + Intergenic
930762617 2:55051581-55051603 CTGGAGGCCCTGGAGAGAAGAGG + Intronic
931517392 2:63058075-63058097 CTGGATGGCGAGGGGGGATGCGG - Intergenic
931942972 2:67273298-67273320 CTGGAGTGCCAGGAGGGAGGTGG - Intergenic
933702361 2:85264466-85264488 CTGGGGGCTCAGGAAGGAAGTGG + Intronic
933760237 2:85667595-85667617 CTGGATGGGCAGGAGGAGAGTGG - Intronic
934507095 2:94903228-94903250 CTTAATATCCAGGAGGGAAGAGG + Intergenic
934768425 2:96893575-96893597 CTGGATGCCAGGGAGGGGATGGG - Intronic
934949638 2:98567489-98567511 CTGGAGCCCCAGCAGGGAGGTGG + Intronic
935127865 2:100239926-100239948 CTGCCTGTCCAGGTGGGAAGAGG + Intergenic
935347242 2:102119948-102119970 GTGGCTGCCAAGGAGGGAAGGGG - Intronic
937373557 2:121319566-121319588 CTGGGTTCCCAGGAGTGCAGGGG + Intergenic
938065584 2:128280374-128280396 CTGCAGGTCCAGGAGGGCAGGGG + Intronic
938327529 2:130421448-130421470 CTGGGTGCCCGGAAGGGGAGGGG + Intergenic
938424992 2:131179150-131179172 CTGGATGGACAGGTGGGATGCGG - Intronic
938570981 2:132561676-132561698 CTGGATACCCAGGAGAGCAAAGG + Intronic
940386987 2:153085406-153085428 CTGGAGGCCTAGGAGGAAAAAGG + Intergenic
940994300 2:160130973-160130995 CTGGAAGGCCAGGAGAGAGGAGG - Intronic
941601733 2:167551176-167551198 CTGTGTGCCCAGGAGGAAAGGGG + Intergenic
941651184 2:168094182-168094204 CTGGATGACTGGGAGGGTAGTGG - Intronic
942543542 2:177039141-177039163 CTGGAAGCCCTGGAGGGAACAGG - Intergenic
944254862 2:197615313-197615335 CTGGATGCCAAAGCGGGCAGAGG + Intronic
946213988 2:218169265-218169287 CTGGAGCCCGAGGAGTGAAGGGG + Intergenic
947339885 2:229127175-229127197 CTGTGTGTCCAGGAGGAAAGGGG + Intronic
948141832 2:235678926-235678948 CTGGATGCCCAGAAGACAAATGG - Intronic
948486881 2:238287122-238287144 CTGGAGTGCCAGGTGGGAAGGGG - Intronic
948541393 2:238693657-238693679 CAGGATGCCCAGGAGCACAGAGG - Intergenic
948689795 2:239694686-239694708 CAGGCTGCCCAGGAGGCATGAGG + Intergenic
949017231 2:241720334-241720356 CTGGGTCCCCAGCAGGGAACAGG - Intronic
949043094 2:241858446-241858468 CTGCCTGCCCAGGAGCAAAGAGG + Intronic
949067026 2:241997837-241997859 CCGGATGTTCAGGAAGGAAGAGG - Intergenic
1168916395 20:1491609-1491631 CTAGGTGCCCGGGAGGGAGGTGG + Intergenic
1169046658 20:2538524-2538546 CTGGATGACTACGAGGGGAGTGG - Intronic
1169213220 20:3778965-3778987 CTGGCTCCCCAGGATGGCAGTGG - Exonic
1171192176 20:23166513-23166535 AGGGATCTCCAGGAGGGAAGTGG + Intergenic
1171424113 20:25038957-25038979 CTGGATGCAGAGGAGGTAGGAGG - Intronic
1171457731 20:25281382-25281404 CTGGACCCCCAGGAAGGCAGGGG - Intronic
1171481411 20:25458375-25458397 CTGGATGCACAGCGGGTAAGTGG - Exonic
1172161469 20:32871753-32871775 CTGCGTGCCTTGGAGGGAAGAGG + Intronic
1173277183 20:41595433-41595455 CTAAATTCCCATGAGGGAAGCGG + Intronic
1173554903 20:43959013-43959035 CTGGAGACCCAGGAGGGCAGTGG - Intronic
1174105749 20:48161162-48161184 CTGGATGAGCAGGAGGGTAAAGG - Intergenic
1174191988 20:48747396-48747418 CTGGATGCCCAGGGCGGGAGCGG + Intronic
1174539459 20:51277534-51277556 CTGGAAGCCACGGAGTGAAGAGG + Intergenic
1175381448 20:58567111-58567133 CTGGAGGGGCAGGAAGGAAGTGG - Intergenic
1175444916 20:59013321-59013343 CTGGCTTTCCAGGAGGGCAGTGG + Intergenic
1175523729 20:59619305-59619327 CTGGAAGCACAGGATGGAAGCGG + Intronic
1175745115 20:61451128-61451150 CAGGATGACACGGAGGGAAGGGG - Intronic
1176985437 21:15431018-15431040 ATGGATGCCCAGGTGGGACTGGG - Intergenic
1179160056 21:38887681-38887703 CTGGATACCCAGGATGGCTGTGG + Intergenic
1180244806 21:46539818-46539840 CTGGGGGGCCAGCAGGGAAGGGG - Intronic
1180466152 22:15613303-15613325 CTGGATGGACAGGTGGGATGCGG - Intergenic
1180880144 22:19197759-19197781 CTGGATGCACTGGAGAGGAGGGG - Intronic
1181546663 22:23606285-23606307 CTGGAAGCCTGGGAGGGAAGTGG - Intergenic
1181937482 22:26449207-26449229 ATGGTTGTCCAGGTGGGAAGTGG - Intronic
1182353750 22:29712966-29712988 ACTGAGGCCCAGGAGGGAAGGGG - Intergenic
1182371352 22:29813298-29813320 CTGCATCCCCAGGCTGGAAGAGG + Intronic
1182505282 22:30777838-30777860 CTGGAAGCCCAGGAAGCCAGTGG + Intronic
1182856324 22:33520565-33520587 CTCAATGCCCAGGTGGGCAGTGG - Intronic
1183378840 22:37480574-37480596 CCCTTTGCCCAGGAGGGAAGTGG - Intronic
1183672550 22:39281595-39281617 CTGGATGTGCAAGAGGGAGGCGG + Intergenic
1184428898 22:44429465-44429487 GTGGGTGCCCAGGGGGCAAGAGG + Intergenic
1184487957 22:44792515-44792537 CTGGAGGAGCAGGAGGGCAGGGG - Intronic
1184585692 22:45446607-45446629 CTGGACGACCAGGACCGAAGGGG - Intergenic
1184691269 22:46118380-46118402 CTGGATGCCCAGGATTTGAGAGG - Intergenic
950447202 3:13045179-13045201 CTGGAAGCACAGGAGGGGTGAGG - Intronic
951531936 3:23706060-23706082 CTAGCTACCCAGGAGGGAGGTGG + Intergenic
952278012 3:31896469-31896491 CTGGATTCCAAGGAGGGAGCTGG - Intronic
952843549 3:37668131-37668153 GTGTCTGCTCAGGAGGGAAGGGG - Intronic
953524411 3:43676557-43676579 TTGTATGTGCAGGAGGGAAGTGG + Intronic
953563997 3:44015476-44015498 CTGGAGGCCCAGCTGGGAGGAGG - Intergenic
953774551 3:45804092-45804114 CTGAAGGCCCAGGAGGGAGTGGG - Intergenic
953917807 3:46931690-46931712 CTGTATGGCCAGGAGGGACCAGG - Intronic
953971940 3:47354943-47354965 CTGGAGGCTCAGGAAGGCAGAGG - Intergenic
954842932 3:53528235-53528257 CTGGATACCCACAAGGGAGGTGG - Intronic
954952679 3:54489104-54489126 GTGGCTGGCCAGGAGGGCAGAGG + Intronic
955344604 3:58151812-58151834 CTGGATGCCCAGGAGTGGGCTGG + Intronic
956263399 3:67370536-67370558 TTGGATGCCCTGCAGGTAAGGGG - Intronic
956435489 3:69231166-69231188 CAGAATGCCCATGAGGAAAGAGG + Intronic
956450996 3:69374808-69374830 CTGGATGGCCACCAGGAAAGGGG - Intronic
960438352 3:117655530-117655552 ATGGATGAGCAGGAAGGAAGTGG + Intergenic
961043486 3:123693545-123693567 CTGGTTGCCCCAGAGAGAAGTGG + Intronic
961365666 3:126397900-126397922 CTGGAGGCCAAGTAGGGAAAGGG + Intronic
962286728 3:134092561-134092583 CTGCATTCCCAGGAAGGAGGAGG + Intronic
963030127 3:140962144-140962166 CTTGATGCCAAGTTGGGAAGAGG - Intronic
963043195 3:141083914-141083936 CTGGAGGCCCTGCAGGGTAGAGG + Intronic
963683586 3:148410676-148410698 CTGGAGGCCTAGGAGGAAAATGG - Intergenic
964913139 3:161806499-161806521 CTAGGTGCTCAGGAGTGAAGGGG - Intergenic
966733381 3:183168821-183168843 TTGGAGGCCCAGGAGGAAAAAGG - Intergenic
967143848 3:186588968-186588990 ATGGAAGTCCAAGAGGGAAGAGG - Intronic
968044447 3:195616197-195616219 CTGGATGCCCAGAAGCACAGTGG - Intergenic
968060237 3:195722248-195722270 CTGGATGCCCAGAAGCACAGTGG - Intronic
968088368 3:195884932-195884954 CTGGGGGCCCAGCAGGGGAGGGG - Exonic
968130943 3:196192506-196192528 GTGGGTGCCCAGGTGGGAGGCGG + Intergenic
968170174 3:196503704-196503726 CTGGCTGCGTAGGAGGGACGGGG - Exonic
968619811 4:1599030-1599052 CTGCCAGGCCAGGAGGGAAGCGG - Intergenic
968627619 4:1634263-1634285 CAGGGTGGGCAGGAGGGAAGAGG + Intronic
968701545 4:2060146-2060168 CAGGATGCCCGGGAGGGGACAGG - Intronic
968746133 4:2361557-2361579 CTTGAGGCCCAGGAGGGCTGGGG + Intronic
969132911 4:5004713-5004735 GTGGATGGCCAGCAGGGGAGGGG + Intergenic
971858956 4:32079595-32079617 CCAGATGCCTAGGAGGGAATAGG - Intergenic
975601633 4:76106230-76106252 CTAGGTGCCCAGGATAGAAGTGG - Intronic
976070911 4:81238825-81238847 CTGGAGGCTGAGGAGGGAGGAGG - Intergenic
976075806 4:81298107-81298129 CTGGATGTCCAGGGGTGCAGGGG + Intergenic
976719765 4:88158641-88158663 CCGGGCGCGCAGGAGGGAAGAGG - Exonic
978114730 4:105005624-105005646 CTGGAATCCCAGAAGGAAAGAGG - Intergenic
978189332 4:105895154-105895176 CAGGGTGCCCAGCAGGAAAGGGG - Intronic
978315449 4:107430788-107430810 CTGGAGGTACAGGAGGGAAAGGG - Intergenic
978589075 4:110304482-110304504 CTGGCAGCCCATGATGGAAGTGG - Intergenic
978657959 4:111088830-111088852 CTGGATTTCCAGCAGGGGAGGGG + Intergenic
979439405 4:120733639-120733661 CTGCATACCCAGAAGGGGAGTGG - Intronic
979502018 4:121451609-121451631 CTGCATGTCCATGAGGGAGGTGG + Intergenic
979615452 4:122737633-122737655 CTGGATATCCATGAGGAAAGAGG + Intronic
980705759 4:136491555-136491577 GTAGATGCCAGGGAGGGAAGAGG + Intergenic
980749627 4:137071161-137071183 CTGGAGGCCCAGGAGGGTTGAGG + Intergenic
982106372 4:152015223-152015245 CATGAGGCCCGGGAGGGAAGTGG + Intergenic
982211506 4:153040239-153040261 CAGGTTGGCCAGGAAGGAAGTGG + Intergenic
985005335 4:185529548-185529570 GTGGATGCCAAGGAGGCACGCGG - Intronic
985787554 5:1906077-1906099 TTGGAGACCCAGGAGGAAAGGGG + Intergenic
986746961 5:10753464-10753486 CTGCCTGCCCAAGTGGGAAGGGG + Intronic
988261046 5:28886594-28886616 CTGGAAGTTTAGGAGGGAAGAGG + Intergenic
988993180 5:36690745-36690767 CAGGATACCCAGAAAGGAAGGGG - Intergenic
989206125 5:38810366-38810388 CTTCATGTCCAGAAGGGAAGAGG + Intergenic
989683416 5:44056881-44056903 CTGTATTCCCACCAGGGAAGGGG + Intergenic
994091026 5:95809758-95809780 CTGGCTGCCAAGCAGGGAAAAGG - Intronic
994141275 5:96344226-96344248 CTGTATGTATAGGAGGGAAGTGG + Intergenic
996093874 5:119377935-119377957 GTAGATGGCCAGGAGGGATGTGG + Intronic
996390281 5:122952943-122952965 CTGGAGTCCCAGAAGGAAAGGGG + Intronic
997296792 5:132773636-132773658 TTGGATGGCAAGGAGGGCAGTGG - Intronic
998148065 5:139741543-139741565 CTGGGTGCCAAGGAGGGCGGTGG + Intergenic
998402103 5:141853408-141853430 CTGCATGACCAGCAGGGAATGGG + Exonic
999073407 5:148771838-148771860 CTGGAAGCCAAGGTGGGAAAGGG - Intergenic
999226442 5:150028812-150028834 TGGGAGGCCGAGGAGGGAAGAGG - Intronic
999321548 5:150618470-150618492 CTGGAAGCCGAGGAGAGCAGCGG + Exonic
999423416 5:151465051-151465073 CTGGAAGAGTAGGAGGGAAGAGG - Intronic
999524117 5:152383846-152383868 CTGGAGACCCAGGAGAGATGAGG - Intergenic
1000327455 5:160183236-160183258 CTGGATGCCAAGCACGGAGGTGG - Intergenic
1001407615 5:171487018-171487040 ATGGAAGCACAGGATGGAAGAGG + Intergenic
1001753583 5:174149646-174149668 CTGGATGCTGAGGAGGGGAGAGG + Intronic
1001894245 5:175364744-175364766 GTGGTTGCCAGGGAGGGAAGAGG - Intergenic
1001956854 5:175853681-175853703 TTGGATGTCCATGAGAGAAGGGG - Intronic
1002021507 5:176366631-176366653 CTGGATTCTCTGCAGGGAAGGGG + Intronic
1002058583 5:176612726-176612748 CTGGATGCTCAGGTGGAAGGTGG + Intergenic
1002076594 5:176712175-176712197 CTGCATCCCTAGGAAGGAAGTGG + Intergenic
1002604536 5:180374686-180374708 CTGGGTGCTGAGGAGAGAAGGGG - Intergenic
1003445248 6:6178018-6178040 CTGGATGCCCTGGAGGCCACAGG + Intronic
1004129799 6:12908761-12908783 CTGGATGCCCAAGCGGTAGGAGG + Intronic
1004246503 6:13982602-13982624 CTGAATGCTCAGTAGGGCAGTGG + Intergenic
1006255472 6:32829214-32829236 ATGGAAGCCCAGGAGGGAACTGG + Intronic
1006435663 6:34024927-34024949 CTGGATGACCAAGAGGGCAGAGG + Intronic
1007304587 6:40893989-40894011 GTGGGGGCCCAGGAGGGAATGGG + Intergenic
1007708265 6:43804723-43804745 CAGGCTGCCAAGGGGGGAAGAGG - Intergenic
1009367987 6:62870444-62870466 CCTGATACCCAGGAGGGGAGAGG + Intergenic
1009994681 6:70884976-70884998 CTGCATGCCAAAGAGAGAAGTGG + Intronic
1011124919 6:83996793-83996815 GTGGTTGCCAAGGAGTGAAGGGG + Intergenic
1013648708 6:112171559-112171581 CTGGATGTGGAGGAGGGAAAGGG + Intronic
1015561958 6:134525574-134525596 CTCTCTGCCCAGGAGGGAAAGGG + Intergenic
1015757771 6:136625368-136625390 CTTAATGCCCAGGAGGGGATAGG + Intronic
1017349678 6:153425722-153425744 CTACATGCCCAGGAGGAAGGAGG - Intergenic
1017409893 6:154156957-154156979 ATGGCTGCTCAGGAAGGAAGTGG - Intronic
1018515498 6:164575354-164575376 CTGGATACATAGGAGGGAAAAGG - Intergenic
1018908830 6:168090303-168090325 CTAGCTGCTCAGGAGGGAGGTGG - Intergenic
1019645163 7:2125027-2125049 CCGGGAGCCCAGCAGGGAAGGGG - Intronic
1020016724 7:4835747-4835769 CTGGCTGCACAGGAGGGCGGGGG + Intronic
1022194840 7:28054794-28054816 CTGGCTGCTCAGGAAGGAAGGGG + Intronic
1023744288 7:43308659-43308681 CTTGTTGCCCAGGAGTGCAGTGG + Intronic
1023872910 7:44272345-44272367 CTGGGTGCCCAGGAGGAGAGGGG - Intronic
1024573808 7:50747739-50747761 ATGGATGCTCAGGAGAGAAGTGG + Intronic
1026843179 7:73682486-73682508 CCGAAAGCCCAGGAGTGAAGGGG - Exonic
1026880067 7:73902214-73902236 CTGGGCGCCCAGGTGGGGAGAGG + Intergenic
1029249513 7:99225897-99225919 ATGGGTGCGCAGGAGGGGAGAGG + Intergenic
1030143733 7:106331764-106331786 CAGGTTGCCCTGGGGGGAAGGGG + Intergenic
1030806779 7:113929513-113929535 CCGGAGGCCCAGGAGAAAAGTGG + Intronic
1031436059 7:121733239-121733261 CTGGTTGCCAAGCAGGGAACAGG - Intergenic
1032036424 7:128524901-128524923 CTCCATGCCCAGCAGGAAAGAGG + Intergenic
1032576323 7:133059031-133059053 CTGGAAGCCCAGGAAGGTTGCGG - Intronic
1033163540 7:139018422-139018444 CCGTATGCCCAGGACGGAGGGGG - Intergenic
1033286794 7:140048283-140048305 CTGGCTGCCCAGGAGGAACATGG - Intronic
1033681585 7:143600754-143600776 CTGGGTGCCCCTGAGGGAAGGGG + Intergenic
1033703307 7:143861059-143861081 CTGGGTGCCCCTGAGGGAAGGGG - Intronic
1034201125 7:149283581-149283603 CTGGAGGCCCAGGGTGGACGTGG - Exonic
1035583565 8:755548-755570 CTGGAAGCCCAGCGGAGAAGCGG + Intergenic
1035866456 8:3088403-3088425 ATGGAAGCCCCAGAGGGAAGTGG - Intronic
1036693195 8:10957682-10957704 CTGGATGGCCAGGAGGGATGGGG - Intronic
1037344383 8:17882493-17882515 CTTGATGCCCAGTGGGTAAGCGG + Intronic
1037529351 8:19757929-19757951 CTGGGAGGCCAGGAGAGAAGAGG + Intronic
1037809737 8:22080449-22080471 CTGGAAGCCCAGGTGAGAAGTGG + Exonic
1039298965 8:36188808-36188830 GTGGTTGCCCAGGAGGAAAATGG - Intergenic
1039304802 8:36249838-36249860 CTGGAGACCCAGGAGGGTTGTGG + Intergenic
1040103842 8:43528065-43528087 CTGGATGCCAAGGTGAGGAGAGG + Intergenic
1041028145 8:53707748-53707770 CTGGATGGCCAGGAAGGATTTGG + Intergenic
1041537535 8:58943574-58943596 CCAGATGCCCAGGAGACAAGAGG + Intronic
1043592179 8:81844671-81844693 CTGAAGGCCCAGGAGTGAATGGG + Intergenic
1047555466 8:125924590-125924612 GAGGATGCCTAGGAAGGAAGTGG - Intergenic
1048302636 8:133262691-133262713 CTGAGTGCCCAGGAGGAAAAGGG - Intronic
1048464739 8:134656055-134656077 CTGACTGCTCAGCAGGGAAGTGG + Intronic
1049324232 8:142013720-142013742 CTGGAGGCAGAAGAGGGAAGGGG - Intergenic
1049465909 8:142751236-142751258 CTGGAAGCCCAGGTCTGAAGAGG + Intronic
1049658300 8:143808550-143808572 CTGGGTGCCCAGGAGGGCCAGGG + Intronic
1051196402 9:14566623-14566645 CTGGATGCCTAGGAAGGCAGGGG + Intergenic
1051734608 9:20185800-20185822 CTGGAAGCCAGGTAGGGAAGGGG + Intergenic
1051764982 9:20513684-20513706 CTGTATGTCCATGAGGGAGGTGG + Intronic
1052764315 9:32625298-32625320 CTGGAGTTCCAGGAGAGAAGGGG - Intergenic
1053283728 9:36837694-36837716 CTGGCAGCCCAGGAGTCAAGTGG + Exonic
1054766184 9:69044534-69044556 CTGGTTGCCATGGAGAGAAGAGG - Intronic
1057034458 9:91801664-91801686 CGGAATCCCCAGGAGGGGAGAGG + Intronic
1059587293 9:115619898-115619920 CTGGAGGCCCAGGAGGAAAAGGG - Intergenic
1059887601 9:118763959-118763981 CTGCATGTCCATGAGGGAGGTGG + Intergenic
1060129747 9:121084518-121084540 CTGTATGCCTAGGATAGAAGAGG + Intronic
1060218018 9:121750062-121750084 CGGGAGGCTCAGGAGGGCAGGGG - Intronic
1060220750 9:121762899-121762921 CTGGATTGCCAGGTGGGCAGTGG + Intronic
1060504386 9:124187322-124187344 CTGGCTGCTCTGGAGGCAAGAGG - Intergenic
1060656343 9:125374993-125375015 GAGGATGCCCAGGAGGGCAGGGG + Intergenic
1060778238 9:126392408-126392430 CTGAATGCGCAGAAGGGCAGGGG - Intronic
1060827572 9:126695585-126695607 CTGGATCCCCTGGAGGGGCGGGG + Intronic
1061296065 9:129677465-129677487 GGGGAGGCCCAGGAGGGATGGGG + Intronic
1061912276 9:133731542-133731564 GTGGATGCCCAGTTGGGGAGGGG - Intronic
1062039352 9:134396934-134396956 CTGGCTGCCCAGGAGGGGGCTGG + Intronic
1062133599 9:134913207-134913229 AGGGAGGCCCAGGAGGGAGGAGG + Intronic
1062172716 9:135144417-135144439 CTTGAAGCCCAGGAAGGAGGAGG + Intergenic
1062221731 9:135419682-135419704 CTTGATGCCCAGTAGGGAGCCGG - Intergenic
1062333452 9:136054612-136054634 CTGTCTGCTCAGGAGGGCAGGGG + Intronic
1062634057 9:137480723-137480745 GGGGCTGCCCAGGCGGGAAGCGG + Intronic
1186190665 X:7064679-7064701 CTGGAGGCCCAGGAGTCAAGGGG - Intronic
1186229809 X:7441000-7441022 CTAGATGCCGGGAAGGGAAGGGG + Intergenic
1186694325 X:12013637-12013659 CTGGATACCCAGGAGGCAGAGGG - Intergenic
1187101627 X:16198812-16198834 CTGGATGCCACAGAGGCAAGAGG - Intergenic
1187437931 X:19289694-19289716 GTGGATTCCCACGAGGGAATCGG - Intergenic
1187942908 X:24399012-24399034 ATGAATACCCAGGAGGGAATTGG + Intergenic
1188457104 X:30379649-30379671 CTGGAGGCTTAGGAGGGAAAGGG + Intergenic
1188766797 X:34102350-34102372 CTTGTTGCCCAGGAGTGCAGTGG - Intergenic
1189471343 X:41316696-41316718 TTCCATGCCCAGGAAGGAAGGGG + Intergenic
1191729040 X:64314369-64314391 GTGGAGGCTCAGGAGGGCAGAGG + Intronic
1191861433 X:65668705-65668727 CCGGATGCCCAGGAGGGAGAGGG + Intronic
1192658855 X:73021685-73021707 CTGGCTGCCCATCTGGGAAGTGG - Intergenic
1195725572 X:107911911-107911933 CTGGGAGCCAAGGAGGGAAAAGG + Intronic
1196889090 X:120275176-120275198 GTGGAGCCCCAGGAGGGAAAAGG - Intronic
1197428069 X:126323180-126323202 CTGAGTTCCCAGGAGGGGAGGGG + Intergenic
1197769799 X:130082721-130082743 CTGGCTGGCGAGGAGGGAGGTGG - Intronic
1197941617 X:131795869-131795891 CTGGGTCCCCTGGAGGGATGGGG + Intergenic
1198026223 X:132710141-132710163 CTGGGAGCCCAGGTGGGAAGAGG + Intronic
1198488255 X:137110160-137110182 CTGGATCCCCTGCAGGGCAGGGG + Intergenic
1198491699 X:137147573-137147595 CTGGCAGCCATGGAGGGAAGGGG - Intergenic
1198530385 X:137546260-137546282 CTCGACCCCAAGGAGGGAAGAGG + Intergenic
1198823407 X:140673600-140673622 CTCACTGCCCACGAGGGAAGAGG - Intergenic
1199765154 X:150935988-150936010 CGGGATGCCCAGGAGTGACAAGG - Intergenic
1200182963 X:154162366-154162388 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200188617 X:154199480-154199502 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200194266 X:154236621-154236643 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200200022 X:154274424-154274446 CAGGAGGCCCAGGAGGGTGGCGG + Intronic
1200408547 Y:2839425-2839447 CTGAATGCCAAGGAGTGAATAGG - Intergenic
1201677747 Y:16605960-16605982 CTGGAATCCCAGAAGGAAAGGGG + Intergenic
1201758859 Y:17517188-17517210 TTGCATGCCCATGAGGGAGGTGG - Intergenic
1201842696 Y:18388802-18388824 TTGCATGCCCATGAGGGAGGTGG + Intergenic