ID: 1142854448

View in Genome Browser
Species Human (GRCh38)
Location 17:2722089-2722111
Sequence GTGAACAGGGTGACTTTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142854448_1142854457 5 Left 1142854448 17:2722089-2722111 CCTAACAAAGTCACCCTGTTCAC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1142854457 17:2722117-2722139 AAGTGTGGTCGTGGGAGATGAGG 0: 1
1: 0
2: 2
3: 27
4: 255
1142854448_1142854453 -3 Left 1142854448 17:2722089-2722111 CCTAACAAAGTCACCCTGTTCAC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1142854453 17:2722109-2722131 CACCCCAAAAGTGTGGTCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 57
1142854448_1142854458 6 Left 1142854448 17:2722089-2722111 CCTAACAAAGTCACCCTGTTCAC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1142854458 17:2722118-2722140 AGTGTGGTCGTGGGAGATGAGGG 0: 1
1: 0
2: 2
3: 21
4: 259
1142854448_1142854452 -4 Left 1142854448 17:2722089-2722111 CCTAACAAAGTCACCCTGTTCAC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1142854452 17:2722108-2722130 TCACCCCAAAAGTGTGGTCGTGG 0: 1
1: 0
2: 0
3: 5
4: 67
1142854448_1142854459 25 Left 1142854448 17:2722089-2722111 CCTAACAAAGTCACCCTGTTCAC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1142854459 17:2722137-2722159 AGGGTCTGTGCACGCTCCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 106
1142854448_1142854450 -10 Left 1142854448 17:2722089-2722111 CCTAACAAAGTCACCCTGTTCAC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1142854450 17:2722102-2722124 CCCTGTTCACCCCAAAAGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142854448 Original CRISPR GTGAACAGGGTGACTTTGTT AGG (reversed) Intergenic
906315742 1:44785434-44785456 GGGGACAGGGTCACCTTGTTGGG + Intronic
907221468 1:52910192-52910214 CTGAACAGGCTGAGTTTGTTTGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909731830 1:78901301-78901323 GTGAAGAGGGTGACATCCTTGGG - Intronic
909796614 1:79747374-79747396 AAGGACAGGCTGACTTTGTTAGG - Intergenic
910324055 1:85983729-85983751 GTTAACAGGGTCAGTATGTTTGG + Intronic
913586697 1:120281428-120281450 GTCAACAAGGAGACTTAGTTAGG + Intergenic
913621489 1:120616942-120616964 GTCAACAAGGAGACTTAGTTAGG - Intergenic
915811000 1:158910272-158910294 ATGGACAGAGAGACTTTGTTTGG + Intergenic
916949643 1:169766444-169766466 GAGAACAGAGTGATTTTTTTGGG - Intronic
919468047 1:197945932-197945954 TTGAACATGGTGATTTTATTTGG + Intergenic
922680458 1:227590930-227590952 GTGATCAGGGTGATTCTTTTGGG + Intronic
924812686 1:247416980-247417002 ATGAACAAGTTGGCTTTGTTTGG - Intronic
1063586232 10:7355481-7355503 GAGAACAGTGTGAATTTGTATGG + Intronic
1064185652 10:13159710-13159732 GTGTACAGTGTCACTTTGTGGGG + Intergenic
1066222016 10:33344544-33344566 GTCTACAGTGTGACTTTCTTGGG + Intergenic
1068675502 10:59765487-59765509 GTGATCAGGGTGATTCTTTTGGG + Intergenic
1068964031 10:62894056-62894078 GTGAAGAGGGTAAGTGTGTTGGG - Intronic
1069319978 10:67157805-67157827 ATGATCAGGGTGATTTTTTTGGG - Intronic
1069765989 10:70860568-70860590 GTGAACAGGGTGACTTTCAGAGG + Intronic
1070400587 10:76050294-76050316 GTGAAAAGGGTGAATTTGGGAGG - Intronic
1070549281 10:77477975-77477997 TTGAACCGGGTGATTTTGTGTGG - Intronic
1075655583 10:124158930-124158952 GTGCAAAGGGTGACTTTCTAAGG - Intergenic
1077408414 11:2392723-2392745 GGGAACAGGGTGGATTTGCTGGG + Intronic
1079947195 11:26758941-26758963 ATGACCAGGGTGACCATGTTTGG + Intergenic
1080584618 11:33670107-33670129 ATGAACAGGCTGAGTTTCTTTGG - Exonic
1081335037 11:41855035-41855057 GCCAACAGGGTGACTGTGTAAGG - Intergenic
1084333851 11:68445843-68445865 GTGAAGGGGGTGCCTTTGTCTGG + Intronic
1085721125 11:78913328-78913350 CTGAACAGGCAGATTTTGTTGGG + Intronic
1087768203 11:102179137-102179159 GTAAAGAGGGTGACATGGTTTGG - Intronic
1088452256 11:109994766-109994788 GTGGTCAGGGTGGCTTTATTAGG - Intergenic
1088817575 11:113432195-113432217 GTGAAAAGGGTCAATCTGTTAGG + Intronic
1092527086 12:9315892-9315914 GTGACCAGGGTGGCTTGGCTCGG - Intergenic
1092540183 12:9415880-9415902 GTGACCAGGGTGGCTTGGCTCGG + Intergenic
1093260252 12:16927906-16927928 GAAAACAGGGTGTCTTGGTTTGG + Intergenic
1098459155 12:70713007-70713029 GTGAGCAGGGAGAATTTTTTTGG - Intronic
1104130729 12:125891476-125891498 GTAAACAGGGTGATATGGTTAGG + Intergenic
1108004755 13:45935262-45935284 GTGAGCAGGGAGCCTTGGTTGGG - Intergenic
1108247417 13:48532333-48532355 GCGAAAAGTTTGACTTTGTTAGG - Intronic
1109332153 13:60943338-60943360 GTGAAGAGGGTGATATGGTTTGG + Intergenic
1110159880 13:72363209-72363231 ATGAACAAGGTAACTTTGGTCGG - Intergenic
1110204173 13:72892051-72892073 ATGAACATGGGGACTTTGTAGGG + Intronic
1119791461 14:77353836-77353858 GGGAACAGTGTTTCTTTGTTGGG - Intronic
1121720028 14:96102896-96102918 GGGGGCAGGGTGACTTTGATGGG - Intergenic
1121956408 14:98217537-98217559 GTGAACAGGGAGACTTTGAAGGG - Intergenic
1122781605 14:104146173-104146195 GTGAACAGGGTGGTTGTTTTTGG + Intronic
1124531011 15:30506486-30506508 GTGTATAGGGGGACTTTGTGTGG + Intergenic
1124767644 15:32501209-32501231 GTGTATAGGGGGACTTTGTGTGG - Intergenic
1130163138 15:81422652-81422674 GAGAAAAGGGTGCCTTGGTTTGG + Intergenic
1141359623 16:83383335-83383357 GGGAAAATGGTGACTTTTTTGGG - Intronic
1142203175 16:88770715-88770737 GTGCTCAGGGTGACTTGGTGCGG - Intronic
1142854448 17:2722089-2722111 GTGAACAGGGTGACTTTGTTAGG - Intergenic
1145900072 17:28484922-28484944 CTGAACAGGGTGACTTCCTTGGG + Intronic
1150102610 17:62437484-62437506 CTGAACAGGGTGAGCTTGTAAGG - Intronic
1151391874 17:73792933-73792955 GTGAAAAGTGTGGCTTAGTTTGG - Intergenic
1154269745 18:12909003-12909025 GTGAAAAGGGTGGCTTTCCTGGG - Intronic
1155532980 18:26786236-26786258 AGGAACAGGATGACTCTGTTGGG + Intergenic
1156516979 18:37688404-37688426 GTGAACTGGGAGAATATGTTTGG - Intergenic
1163417123 19:17193484-17193506 GTGAACAGGGTGCCTAGGTCGGG - Intronic
1166234941 19:41449121-41449143 GGGAAAAGGGGGAATTTGTTTGG - Intergenic
1167167502 19:47809055-47809077 TTGAACACAGAGACTTTGTTGGG + Intronic
926680668 2:15661681-15661703 GTGAACCAGGTGACCTTTTTAGG - Intergenic
927994150 2:27470935-27470957 GTGAACATGGTGACTCTCTCAGG + Exonic
930362402 2:50398456-50398478 GTGAACAAGGTTATTATGTTAGG + Intronic
935951496 2:108333930-108333952 GTCAACAAGGTCACTTTCTTAGG - Intergenic
937534421 2:122868078-122868100 GTGAACATTGTGAGATTGTTAGG - Intergenic
939514290 2:143147315-143147337 GAAAACAGGGTGACTATCTTAGG - Intronic
940480695 2:154227233-154227255 GAGAAAAGGGTGACTTTTTCTGG + Intronic
940849240 2:158672541-158672563 GAGAACAGGGTGGCTATGTGGGG + Intronic
941545430 2:166844475-166844497 GGGAACTGGGTGACATTATTGGG + Intergenic
945477453 2:210301739-210301761 GTGAAAAGGTTGACTTTTTAGGG + Intronic
947104144 2:226650547-226650569 GTGTAAACGCTGACTTTGTTGGG - Intergenic
1182984433 22:34703050-34703072 TTGAACAGAGTGACTCTGGTGGG + Intergenic
1184485687 22:44777517-44777539 CTGAGCAGGGTCACTCTGTTGGG + Intronic
950512557 3:13440172-13440194 GTGACCAGGCTGACTCTGTGTGG - Intergenic
950535102 3:13574102-13574124 CTCAACACGGTGACTCTGTTAGG - Intronic
951183784 3:19688737-19688759 GTCAACAGGGTTACATTCTTAGG - Intergenic
953113166 3:39963515-39963537 ATGAAATAGGTGACTTTGTTTGG + Intronic
953533775 3:43761286-43761308 GTGCTCAGGGTGGATTTGTTAGG + Intergenic
953910193 3:46888921-46888943 CTGAACAGGCTGCCTGTGTTTGG - Intronic
954373596 3:50183081-50183103 GCGATCAGGGTGCCTTTGGTGGG + Intronic
955029741 3:55204725-55204747 GTGGACAGTGTGGATTTGTTGGG + Intergenic
957255194 3:77827159-77827181 CTGAACAGTGTGACTTTCTTGGG - Intergenic
957818474 3:85335924-85335946 GAGAACAGGCTGTCTTTGTATGG - Intronic
960294976 3:115931723-115931745 GTGTACAGGATGACTGTGATAGG - Intronic
960817367 3:121687985-121688007 CTGAACAGAGAGGCTTTGTTCGG + Intronic
962837553 3:139202653-139202675 GTTGACAGGATGACTTTGTAGGG + Intronic
964624295 3:158744442-158744464 GTGCACAGGGTGAGTTGGGTTGG + Intronic
973264243 4:48195192-48195214 GTGACTAGGGTTACTTGGTTGGG + Intronic
975799914 4:78049652-78049674 GTGCACAAGGTGACTTTGAGGGG - Intergenic
976515041 4:85955276-85955298 GGGAATTGGGTGAATTTGTTAGG - Intronic
978419222 4:108512158-108512180 GTGGACAGTGGGACTATGTTTGG - Intergenic
979072090 4:116221127-116221149 GTTAACAGGGTCACTCTGTCAGG + Intergenic
980470409 4:133242915-133242937 TTGAACAAGGTGACTATGATAGG - Intergenic
982065091 4:151647489-151647511 GTGGACAGAATGACATTGTTGGG - Intronic
982274664 4:153627075-153627097 GTTAAGAGGGTGAGTTTGTGAGG + Intronic
983166092 4:164478577-164478599 GTTAAAATGGTGTCTTTGTTGGG + Intergenic
983829769 4:172311771-172311793 GTGATCAGGGTGGGTTTTTTTGG + Intronic
984544974 4:181090717-181090739 GTGAAGACGGTTACATTGTTGGG - Intergenic
986096500 5:4559673-4559695 ATGAACAGGCTTAGTTTGTTGGG + Intergenic
992770142 5:80040005-80040027 GAAAACAGGGTTTCTTTGTTTGG - Intronic
997655456 5:135550931-135550953 ATGTACAGGGTGACATTGTGGGG + Intergenic
1001121031 5:168980022-168980044 GTGAACAGGATGACAATGTCTGG - Intronic
1002181536 5:177433441-177433463 GTGAATAGGGTGGGTGTGTTGGG + Intronic
1002476417 5:179468970-179468992 CTGACCAGGGTGACTTTGAAAGG + Intergenic
1003692955 6:8372842-8372864 ATGAAAAGGATGACTTGGTTAGG - Intergenic
1004030770 6:11867037-11867059 GTGAACAGGTTGGCCATGTTTGG + Intergenic
1005583919 6:27258149-27258171 GTGAAGGGGTTGACTTTATTTGG - Intergenic
1006188146 6:32191975-32191997 GTGGACAGGGTGACGTGATTAGG + Intronic
1009562477 6:65265678-65265700 GAAAACAGGATGACTTTGTGGGG + Intronic
1013854991 6:114561566-114561588 GTTAGCCGTGTGACTTTGTTAGG + Intergenic
1015542973 6:134334555-134334577 GTGATCAGTGTGAATATGTTGGG + Intergenic
1015944444 6:138485907-138485929 GTGAAAAGGATGACTTTATTTGG - Intronic
1017153283 6:151300436-151300458 GTGAAAAGGGTTGCTTTGGTTGG + Intronic
1019353546 7:567071-567093 GTGGGGAGTGTGACTTTGTTGGG + Intronic
1021624065 7:22575614-22575636 ATGAACAGGGTGACCGAGTTTGG + Intronic
1024928035 7:54638480-54638502 ACGAACAGGGTGATTTTGATCGG - Intergenic
1028292600 7:89085089-89085111 CTGAACAGGGTTACTTGATTTGG - Intronic
1028674918 7:93448021-93448043 GTGAAGATGGTGAGTTTCTTAGG - Intronic
1032031814 7:128490673-128490695 CTGAACAGGGTGAGCTTGTAAGG - Intronic
1033446226 7:141424667-141424689 GTTAACAGGGAGGCTTTTTTGGG - Intronic
1036165630 8:6430012-6430034 GCAAACAGGGTGACATTGTGGGG - Intronic
1039066934 8:33617283-33617305 CTTTACAGGCTGACTTTGTTAGG + Intergenic
1040588187 8:48764208-48764230 GTGAACAGAGTGGCTTTCTGTGG + Intergenic
1042742201 8:72062374-72062396 GTGAACGTGTTGACTGTGTTTGG - Intronic
1042757891 8:72237630-72237652 GTGAAAATGCTGACTGTGTTTGG - Intergenic
1046466235 8:114607639-114607661 GTAAACAGAGTGACTATCTTGGG - Intergenic
1047243455 8:123116619-123116641 GTTACCAGGGTGTCATTGTTAGG - Intronic
1047848547 8:128830475-128830497 GTGAACAGGCTGCCTTTGATGGG - Intergenic
1048722180 8:137337952-137337974 GTGAGCAGTGTGACTTTGACAGG - Intergenic
1049797942 8:144505087-144505109 GTGGACAGGAAGACGTTGTTGGG - Exonic
1051566445 9:18504720-18504742 GTGTACATGGTGGCTTTGCTAGG - Intronic
1051783623 9:20718217-20718239 ATGAACAGAGTGGCTCTGTTTGG + Intronic
1055063269 9:72092650-72092672 GGGAGCTAGGTGACTTTGTTTGG - Intergenic
1055799613 9:80020771-80020793 GTGATCAGGCTGACTTCTTTTGG + Intergenic
1056946310 9:91000362-91000384 TTAAACATGTTGACTTTGTTTGG - Intergenic
1057450113 9:95150806-95150828 GTGAACAGCAGGACTTTATTTGG - Intronic
1062134549 9:134918083-134918105 GGGAGCAGGGTGTCTTTGCTGGG - Intergenic
1188131187 X:26434508-26434530 GTTAACTTGGTGTCTTTGTTGGG + Intergenic
1190785593 X:53645081-53645103 TTGAACAGAGAGATTTTGTTTGG + Intronic
1199290908 X:146104342-146104364 GTAAACAGGGTGACTTAGTGGGG + Intergenic