ID: 1142856519

View in Genome Browser
Species Human (GRCh38)
Location 17:2733553-2733575
Sequence AAAATTATGAGAAGAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142856519_1142856525 10 Left 1142856519 17:2733553-2733575 CCAGCTCCTCTTCTCATAATTTT No data
Right 1142856525 17:2733586-2733608 TGAAAAGGTGGCATCAGGCAGGG No data
1142856519_1142856527 24 Left 1142856519 17:2733553-2733575 CCAGCTCCTCTTCTCATAATTTT No data
Right 1142856527 17:2733600-2733622 CAGGCAGGGCTGAGATACTTGGG No data
1142856519_1142856521 -5 Left 1142856519 17:2733553-2733575 CCAGCTCCTCTTCTCATAATTTT No data
Right 1142856521 17:2733571-2733593 ATTTTGTTATTGCAATGAAAAGG No data
1142856519_1142856526 23 Left 1142856519 17:2733553-2733575 CCAGCTCCTCTTCTCATAATTTT No data
Right 1142856526 17:2733599-2733621 TCAGGCAGGGCTGAGATACTTGG No data
1142856519_1142856522 -2 Left 1142856519 17:2733553-2733575 CCAGCTCCTCTTCTCATAATTTT No data
Right 1142856522 17:2733574-2733596 TTGTTATTGCAATGAAAAGGTGG No data
1142856519_1142856524 9 Left 1142856519 17:2733553-2733575 CCAGCTCCTCTTCTCATAATTTT No data
Right 1142856524 17:2733585-2733607 ATGAAAAGGTGGCATCAGGCAGG No data
1142856519_1142856523 5 Left 1142856519 17:2733553-2733575 CCAGCTCCTCTTCTCATAATTTT No data
Right 1142856523 17:2733581-2733603 TGCAATGAAAAGGTGGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142856519 Original CRISPR AAAATTATGAGAAGAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr