ID: 1142858941

View in Genome Browser
Species Human (GRCh38)
Location 17:2749504-2749526
Sequence GGGATCTGCAGCGCCCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142858935_1142858941 -3 Left 1142858935 17:2749484-2749506 CCCCACGCTAGCTGCGCCCGGGG No data
Right 1142858941 17:2749504-2749526 GGGATCTGCAGCGCCCGCCCCGG No data
1142858933_1142858941 -2 Left 1142858933 17:2749483-2749505 CCCCCACGCTAGCTGCGCCCGGG No data
Right 1142858941 17:2749504-2749526 GGGATCTGCAGCGCCCGCCCCGG No data
1142858937_1142858941 -4 Left 1142858937 17:2749485-2749507 CCCACGCTAGCTGCGCCCGGGGA No data
Right 1142858941 17:2749504-2749526 GGGATCTGCAGCGCCCGCCCCGG No data
1142858930_1142858941 25 Left 1142858930 17:2749456-2749478 CCGGGCTGGGTGGGGGCGGCGCT No data
Right 1142858941 17:2749504-2749526 GGGATCTGCAGCGCCCGCCCCGG No data
1142858938_1142858941 -5 Left 1142858938 17:2749486-2749508 CCACGCTAGCTGCGCCCGGGGAT No data
Right 1142858941 17:2749504-2749526 GGGATCTGCAGCGCCCGCCCCGG No data
1142858931_1142858941 -1 Left 1142858931 17:2749482-2749504 CCCCCCACGCTAGCTGCGCCCGG No data
Right 1142858941 17:2749504-2749526 GGGATCTGCAGCGCCCGCCCCGG No data
1142858928_1142858941 30 Left 1142858928 17:2749451-2749473 CCGGGCCGGGCTGGGTGGGGGCG No data
Right 1142858941 17:2749504-2749526 GGGATCTGCAGCGCCCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142858941 Original CRISPR GGGATCTGCAGCGCCCGCCC CGG Intergenic
No off target data available for this crispr