ID: 1142859101

View in Genome Browser
Species Human (GRCh38)
Location 17:2749954-2749976
Sequence CGGAGCGGATCGCGGCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142859101_1142859117 28 Left 1142859101 17:2749954-2749976 CCGCCAGGCCGCGATCCGCTCCG No data
Right 1142859117 17:2750005-2750027 GGCAGCGCCCGCAGCCGCGCAGG No data
1142859101_1142859107 -2 Left 1142859101 17:2749954-2749976 CCGCCAGGCCGCGATCCGCTCCG No data
Right 1142859107 17:2749975-2749997 CGCCCCTCCCGCCCTGGCGTAGG No data
1142859101_1142859105 -8 Left 1142859101 17:2749954-2749976 CCGCCAGGCCGCGATCCGCTCCG No data
Right 1142859105 17:2749969-2749991 CCGCTCCGCCCCTCCCGCCCTGG No data
1142859101_1142859111 2 Left 1142859101 17:2749954-2749976 CCGCCAGGCCGCGATCCGCTCCG No data
Right 1142859111 17:2749979-2750001 CCTCCCGCCCTGGCGTAGGAAGG No data
1142859101_1142859114 7 Left 1142859101 17:2749954-2749976 CCGCCAGGCCGCGATCCGCTCCG No data
Right 1142859114 17:2749984-2750006 CGCCCTGGCGTAGGAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142859101 Original CRISPR CGGAGCGGATCGCGGCCTGG CGG (reversed) Intergenic