ID: 1142859103

View in Genome Browser
Species Human (GRCh38)
Location 17:2749962-2749984
Sequence GGGAGGGGCGGAGCGGATCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142859103_1142859114 -1 Left 1142859103 17:2749962-2749984 CCGCGATCCGCTCCGCCCCTCCC No data
Right 1142859114 17:2749984-2750006 CGCCCTGGCGTAGGAAGGAGAGG No data
1142859103_1142859118 25 Left 1142859103 17:2749962-2749984 CCGCGATCCGCTCCGCCCCTCCC No data
Right 1142859118 17:2750010-2750032 CGCCCGCAGCCGCGCAGGCAAGG No data
1142859103_1142859117 20 Left 1142859103 17:2749962-2749984 CCGCGATCCGCTCCGCCCCTCCC No data
Right 1142859117 17:2750005-2750027 GGCAGCGCCCGCAGCCGCGCAGG No data
1142859103_1142859111 -6 Left 1142859103 17:2749962-2749984 CCGCGATCCGCTCCGCCCCTCCC No data
Right 1142859111 17:2749979-2750001 CCTCCCGCCCTGGCGTAGGAAGG No data
1142859103_1142859121 30 Left 1142859103 17:2749962-2749984 CCGCGATCCGCTCCGCCCCTCCC No data
Right 1142859121 17:2750015-2750037 GCAGCCGCGCAGGCAAGGCTTGG No data
1142859103_1142859107 -10 Left 1142859103 17:2749962-2749984 CCGCGATCCGCTCCGCCCCTCCC No data
Right 1142859107 17:2749975-2749997 CGCCCCTCCCGCCCTGGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142859103 Original CRISPR GGGAGGGGCGGAGCGGATCG CGG (reversed) Intergenic