ID: 1142859104

View in Genome Browser
Species Human (GRCh38)
Location 17:2749969-2749991
Sequence CCAGGGCGGGAGGGGCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142859104_1142859123 25 Left 1142859104 17:2749969-2749991 CCGCTCCGCCCCTCCCGCCCTGG No data
Right 1142859123 17:2750017-2750039 AGCCGCGCAGGCAAGGCTTGGGG No data
1142859104_1142859118 18 Left 1142859104 17:2749969-2749991 CCGCTCCGCCCCTCCCGCCCTGG No data
Right 1142859118 17:2750010-2750032 CGCCCGCAGCCGCGCAGGCAAGG No data
1142859104_1142859117 13 Left 1142859104 17:2749969-2749991 CCGCTCCGCCCCTCCCGCCCTGG No data
Right 1142859117 17:2750005-2750027 GGCAGCGCCCGCAGCCGCGCAGG No data
1142859104_1142859122 24 Left 1142859104 17:2749969-2749991 CCGCTCCGCCCCTCCCGCCCTGG No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data
1142859104_1142859114 -8 Left 1142859104 17:2749969-2749991 CCGCTCCGCCCCTCCCGCCCTGG No data
Right 1142859114 17:2749984-2750006 CGCCCTGGCGTAGGAAGGAGAGG No data
1142859104_1142859121 23 Left 1142859104 17:2749969-2749991 CCGCTCCGCCCCTCCCGCCCTGG No data
Right 1142859121 17:2750015-2750037 GCAGCCGCGCAGGCAAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142859104 Original CRISPR CCAGGGCGGGAGGGGCGGAG CGG (reversed) Intergenic