ID: 1142859106

View in Genome Browser
Species Human (GRCh38)
Location 17:2749974-2749996
Sequence CTACGCCAGGGCGGGAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142859106_1142859118 13 Left 1142859106 17:2749974-2749996 CCGCCCCTCCCGCCCTGGCGTAG No data
Right 1142859118 17:2750010-2750032 CGCCCGCAGCCGCGCAGGCAAGG No data
1142859106_1142859121 18 Left 1142859106 17:2749974-2749996 CCGCCCCTCCCGCCCTGGCGTAG No data
Right 1142859121 17:2750015-2750037 GCAGCCGCGCAGGCAAGGCTTGG No data
1142859106_1142859117 8 Left 1142859106 17:2749974-2749996 CCGCCCCTCCCGCCCTGGCGTAG No data
Right 1142859117 17:2750005-2750027 GGCAGCGCCCGCAGCCGCGCAGG No data
1142859106_1142859122 19 Left 1142859106 17:2749974-2749996 CCGCCCCTCCCGCCCTGGCGTAG No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data
1142859106_1142859123 20 Left 1142859106 17:2749974-2749996 CCGCCCCTCCCGCCCTGGCGTAG No data
Right 1142859123 17:2750017-2750039 AGCCGCGCAGGCAAGGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142859106 Original CRISPR CTACGCCAGGGCGGGAGGGG CGG (reversed) Intergenic
No off target data available for this crispr