ID: 1142859116

View in Genome Browser
Species Human (GRCh38)
Location 17:2749987-2750009
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142859116_1142859121 5 Left 1142859116 17:2749987-2750009 CCTGGCGTAGGAAGGAGAGGCAG No data
Right 1142859121 17:2750015-2750037 GCAGCCGCGCAGGCAAGGCTTGG No data
1142859116_1142859126 30 Left 1142859116 17:2749987-2750009 CCTGGCGTAGGAAGGAGAGGCAG No data
Right 1142859126 17:2750040-2750062 CGAAGCGCGATCTGACCAGTGGG No data
1142859116_1142859125 29 Left 1142859116 17:2749987-2750009 CCTGGCGTAGGAAGGAGAGGCAG No data
Right 1142859125 17:2750039-2750061 GCGAAGCGCGATCTGACCAGTGG No data
1142859116_1142859118 0 Left 1142859116 17:2749987-2750009 CCTGGCGTAGGAAGGAGAGGCAG No data
Right 1142859118 17:2750010-2750032 CGCCCGCAGCCGCGCAGGCAAGG No data
1142859116_1142859123 7 Left 1142859116 17:2749987-2750009 CCTGGCGTAGGAAGGAGAGGCAG No data
Right 1142859123 17:2750017-2750039 AGCCGCGCAGGCAAGGCTTGGGG No data
1142859116_1142859117 -5 Left 1142859116 17:2749987-2750009 CCTGGCGTAGGAAGGAGAGGCAG No data
Right 1142859117 17:2750005-2750027 GGCAGCGCCCGCAGCCGCGCAGG No data
1142859116_1142859122 6 Left 1142859116 17:2749987-2750009 CCTGGCGTAGGAAGGAGAGGCAG No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142859116 Original CRISPR CTGCCTCTCCTTCCTACGCC AGG (reversed) Intergenic