ID: 1142859122

View in Genome Browser
Species Human (GRCh38)
Location 17:2750016-2750038
Sequence CAGCCGCGCAGGCAAGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142859108_1142859122 16 Left 1142859108 17:2749977-2749999 CCCCTCCCGCCCTGGCGTAGGAA No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data
1142859112_1142859122 11 Left 1142859112 17:2749982-2750004 CCCGCCCTGGCGTAGGAAGGAGA No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data
1142859115_1142859122 7 Left 1142859115 17:2749986-2750008 CCCTGGCGTAGGAAGGAGAGGCA No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data
1142859106_1142859122 19 Left 1142859106 17:2749974-2749996 CCGCCCCTCCCGCCCTGGCGTAG No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data
1142859109_1142859122 15 Left 1142859109 17:2749978-2750000 CCCTCCCGCCCTGGCGTAGGAAG No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data
1142859104_1142859122 24 Left 1142859104 17:2749969-2749991 CCGCTCCGCCCCTCCCGCCCTGG No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data
1142859116_1142859122 6 Left 1142859116 17:2749987-2750009 CCTGGCGTAGGAAGGAGAGGCAG No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data
1142859110_1142859122 14 Left 1142859110 17:2749979-2750001 CCTCCCGCCCTGGCGTAGGAAGG No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data
1142859113_1142859122 10 Left 1142859113 17:2749983-2750005 CCGCCCTGGCGTAGGAAGGAGAG No data
Right 1142859122 17:2750016-2750038 CAGCCGCGCAGGCAAGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142859122 Original CRISPR CAGCCGCGCAGGCAAGGCTT GGG Intergenic
No off target data available for this crispr