ID: 1142859658

View in Genome Browser
Species Human (GRCh38)
Location 17:2753636-2753658
Sequence GGTAAGGGCCAAAGTGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142859651_1142859658 16 Left 1142859651 17:2753597-2753619 CCAGCTGTGGCAGCCACAGTGGT No data
Right 1142859658 17:2753636-2753658 GGTAAGGGCCAAAGTGTGCAAGG No data
1142859652_1142859658 3 Left 1142859652 17:2753610-2753632 CCACAGTGGTCATAGCTTAAAGG No data
Right 1142859658 17:2753636-2753658 GGTAAGGGCCAAAGTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142859658 Original CRISPR GGTAAGGGCCAAAGTGTGCA AGG Intergenic
No off target data available for this crispr