ID: 1142859952

View in Genome Browser
Species Human (GRCh38)
Location 17:2755522-2755544
Sequence CGCCGGCCCCGCAGAACGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142859952_1142859959 4 Left 1142859952 17:2755522-2755544 CCGCCCGTTCTGCGGGGCCGGCG No data
Right 1142859959 17:2755549-2755571 CCCGGCTCCAGCCGCCTCCAGGG No data
1142859952_1142859964 10 Left 1142859952 17:2755522-2755544 CCGCCCGTTCTGCGGGGCCGGCG No data
Right 1142859964 17:2755555-2755577 TCCAGCCGCCTCCAGGGGCGGGG No data
1142859952_1142859957 3 Left 1142859952 17:2755522-2755544 CCGCCCGTTCTGCGGGGCCGGCG No data
Right 1142859957 17:2755548-2755570 ACCCGGCTCCAGCCGCCTCCAGG No data
1142859952_1142859963 9 Left 1142859952 17:2755522-2755544 CCGCCCGTTCTGCGGGGCCGGCG No data
Right 1142859963 17:2755554-2755576 CTCCAGCCGCCTCCAGGGGCGGG No data
1142859952_1142859961 5 Left 1142859952 17:2755522-2755544 CCGCCCGTTCTGCGGGGCCGGCG No data
Right 1142859961 17:2755550-2755572 CCGGCTCCAGCCGCCTCCAGGGG No data
1142859952_1142859962 8 Left 1142859952 17:2755522-2755544 CCGCCCGTTCTGCGGGGCCGGCG No data
Right 1142859962 17:2755553-2755575 GCTCCAGCCGCCTCCAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142859952 Original CRISPR CGCCGGCCCCGCAGAACGGG CGG (reversed) Intergenic
No off target data available for this crispr