ID: 1142861706

View in Genome Browser
Species Human (GRCh38)
Location 17:2766148-2766170
Sequence AACCCAACCTCTTTTAGATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142861705_1142861706 -7 Left 1142861705 17:2766132-2766154 CCTTGTGCTCTGCAGCAACCCAA No data
Right 1142861706 17:2766148-2766170 AACCCAACCTCTTTTAGATCCGG No data
1142861704_1142861706 11 Left 1142861704 17:2766114-2766136 CCATGGGGGCGGTGGCAGCCTTG No data
Right 1142861706 17:2766148-2766170 AACCCAACCTCTTTTAGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142861706 Original CRISPR AACCCAACCTCTTTTAGATC CGG Intergenic
No off target data available for this crispr