ID: 1142862483

View in Genome Browser
Species Human (GRCh38)
Location 17:2771255-2771277
Sequence TGGGATCCTGAGTCTGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142862473_1142862483 2 Left 1142862473 17:2771230-2771252 CCTTTCCCATGCCAGAGAGTCCA No data
Right 1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG No data
1142862478_1142862483 -9 Left 1142862478 17:2771241-2771263 CCAGAGAGTCCAGCTGGGATCCT No data
Right 1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG No data
1142862474_1142862483 -3 Left 1142862474 17:2771235-2771257 CCCATGCCAGAGAGTCCAGCTGG No data
Right 1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG No data
1142862476_1142862483 -4 Left 1142862476 17:2771236-2771258 CCATGCCAGAGAGTCCAGCTGGG No data
Right 1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG No data
1142862472_1142862483 5 Left 1142862472 17:2771227-2771249 CCTCCTTTCCCATGCCAGAGAGT No data
Right 1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG No data
1142862469_1142862483 23 Left 1142862469 17:2771209-2771231 CCGTGCCTTCTTTGTCCGCCTCC No data
Right 1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG No data
1142862470_1142862483 18 Left 1142862470 17:2771214-2771236 CCTTCTTTGTCCGCCTCCTTTCC No data
Right 1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG No data
1142862471_1142862483 8 Left 1142862471 17:2771224-2771246 CCGCCTCCTTTCCCATGCCAGAG No data
Right 1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG No data
1142862468_1142862483 27 Left 1142862468 17:2771205-2771227 CCAGCCGTGCCTTCTTTGTCCGC No data
Right 1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142862483 Original CRISPR TGGGATCCTGAGTCTGGGTA GGG Intergenic
No off target data available for this crispr