ID: 1142863373

View in Genome Browser
Species Human (GRCh38)
Location 17:2776685-2776707
Sequence CTGCGCGTGCGCGGCGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142863366_1142863373 0 Left 1142863366 17:2776662-2776684 CCCTGGATCGGCGCGGGCTCCGG No data
Right 1142863373 17:2776685-2776707 CTGCGCGTGCGCGGCGGCGGCGG No data
1142863365_1142863373 5 Left 1142863365 17:2776657-2776679 CCGGACCCTGGATCGGCGCGGGC No data
Right 1142863373 17:2776685-2776707 CTGCGCGTGCGCGGCGGCGGCGG No data
1142863363_1142863373 6 Left 1142863363 17:2776656-2776678 CCCGGACCCTGGATCGGCGCGGG No data
Right 1142863373 17:2776685-2776707 CTGCGCGTGCGCGGCGGCGGCGG No data
1142863368_1142863373 -1 Left 1142863368 17:2776663-2776685 CCTGGATCGGCGCGGGCTCCGGC No data
Right 1142863373 17:2776685-2776707 CTGCGCGTGCGCGGCGGCGGCGG No data
1142863361_1142863373 7 Left 1142863361 17:2776655-2776677 CCCCGGACCCTGGATCGGCGCGG No data
Right 1142863373 17:2776685-2776707 CTGCGCGTGCGCGGCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142863373 Original CRISPR CTGCGCGTGCGCGGCGGCGG CGG Intergenic
No off target data available for this crispr