ID: 1142863397

View in Genome Browser
Species Human (GRCh38)
Location 17:2776773-2776795
Sequence TGCCGCGCACGCGCGCACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142863397_1142863410 22 Left 1142863397 17:2776773-2776795 CCGGGGTGCGCGCGTGCGCGGCA No data
Right 1142863410 17:2776818-2776840 CGCCCCGGAGGAGGAGGAGGAGG No data
1142863397_1142863400 -8 Left 1142863397 17:2776773-2776795 CCGGGGTGCGCGCGTGCGCGGCA No data
Right 1142863400 17:2776788-2776810 GCGCGGCAGGACTGCTGCGAGGG No data
1142863397_1142863401 7 Left 1142863397 17:2776773-2776795 CCGGGGTGCGCGCGTGCGCGGCA No data
Right 1142863401 17:2776803-2776825 TGCGAGGGACCCCGCCGCCCCGG No data
1142863397_1142863408 19 Left 1142863397 17:2776773-2776795 CCGGGGTGCGCGCGTGCGCGGCA No data
Right 1142863408 17:2776815-2776837 CGCCGCCCCGGAGGAGGAGGAGG No data
1142863397_1142863413 25 Left 1142863397 17:2776773-2776795 CCGGGGTGCGCGCGTGCGCGGCA No data
Right 1142863413 17:2776821-2776843 CCCGGAGGAGGAGGAGGAGGAGG No data
1142863397_1142863405 16 Left 1142863397 17:2776773-2776795 CCGGGGTGCGCGCGTGCGCGGCA No data
Right 1142863405 17:2776812-2776834 CCCCGCCGCCCCGGAGGAGGAGG No data
1142863397_1142863403 13 Left 1142863397 17:2776773-2776795 CCGGGGTGCGCGCGTGCGCGGCA No data
Right 1142863403 17:2776809-2776831 GGACCCCGCCGCCCCGGAGGAGG No data
1142863397_1142863415 28 Left 1142863397 17:2776773-2776795 CCGGGGTGCGCGCGTGCGCGGCA No data
Right 1142863415 17:2776824-2776846 GGAGGAGGAGGAGGAGGAGGAGG No data
1142863397_1142863399 -9 Left 1142863397 17:2776773-2776795 CCGGGGTGCGCGCGTGCGCGGCA No data
Right 1142863399 17:2776787-2776809 TGCGCGGCAGGACTGCTGCGAGG No data
1142863397_1142863402 10 Left 1142863397 17:2776773-2776795 CCGGGGTGCGCGCGTGCGCGGCA No data
Right 1142863402 17:2776806-2776828 GAGGGACCCCGCCGCCCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142863397 Original CRISPR TGCCGCGCACGCGCGCACCC CGG (reversed) Intergenic