ID: 1142863966

View in Genome Browser
Species Human (GRCh38)
Location 17:2779332-2779354
Sequence CTGGCCACACAGAAATACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142863966_1142863970 -4 Left 1142863966 17:2779332-2779354 CCGGGGTATTTCTGTGTGGCCAG 0: 1
1: 0
2: 3
3: 20
4: 214
Right 1142863970 17:2779351-2779373 CCAGGAAGACCACATGCCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 268
1142863966_1142863977 30 Left 1142863966 17:2779332-2779354 CCGGGGTATTTCTGTGTGGCCAG 0: 1
1: 0
2: 3
3: 20
4: 214
Right 1142863977 17:2779385-2779407 GTCATTCACTCAAGTGGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 113
1142863966_1142863975 24 Left 1142863966 17:2779332-2779354 CCGGGGTATTTCTGTGTGGCCAG 0: 1
1: 0
2: 3
3: 20
4: 214
Right 1142863975 17:2779379-2779401 CAGATAGTCATTCACTCAAGTGG 0: 1
1: 1
2: 2
3: 7
4: 84
1142863966_1142863976 27 Left 1142863966 17:2779332-2779354 CCGGGGTATTTCTGTGTGGCCAG 0: 1
1: 0
2: 3
3: 20
4: 214
Right 1142863976 17:2779382-2779404 ATAGTCATTCACTCAAGTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 82
1142863966_1142863971 -1 Left 1142863966 17:2779332-2779354 CCGGGGTATTTCTGTGTGGCCAG 0: 1
1: 0
2: 3
3: 20
4: 214
Right 1142863971 17:2779354-2779376 GGAAGACCACATGCCCAGGGTGG 0: 1
1: 0
2: 0
3: 25
4: 231
1142863966_1142863968 -5 Left 1142863966 17:2779332-2779354 CCGGGGTATTTCTGTGTGGCCAG 0: 1
1: 0
2: 3
3: 20
4: 214
Right 1142863968 17:2779350-2779372 GCCAGGAAGACCACATGCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142863966 Original CRISPR CTGGCCACACAGAAATACCC CGG (reversed) Intronic
902339864 1:15775935-15775957 CTGGCCATAAAGAAATTCTCTGG - Intronic
904465826 1:30707096-30707118 CTGGCCACACAGTGATAATCAGG + Intergenic
906075169 1:43046701-43046723 CTGGCCACCGAGAAGGACCCGGG + Intergenic
906100555 1:43257702-43257724 CTGGGCACACAGATGTTCCCAGG - Intronic
906513521 1:46424711-46424733 CAGGCCACACAGCAAATCCCAGG - Intergenic
906666833 1:47628016-47628038 CTGGCCACACAGCAGAGCCCTGG - Intergenic
907617458 1:55939019-55939041 CTGGCCACACAGGGAGCCCCGGG + Intergenic
911462763 1:98211618-98211640 CTGTCCACACATGAATAACCTGG - Intergenic
912480549 1:109979290-109979312 CTGGTCACACAGCCAGACCCCGG + Intergenic
917986193 1:180321520-180321542 GTAGCCACAGATAAATACCCAGG - Intronic
922666339 1:227472730-227472752 CAGGCCACACAAAAATTCCTGGG - Intergenic
1062834953 10:629384-629406 CTGGACACACAGACACTCCCAGG + Intronic
1063071744 10:2672866-2672888 CTGGAGACAAAGAAACACCCTGG + Intergenic
1063436349 10:6035281-6035303 CTGCCCACACAGGGAGACCCAGG - Intronic
1065105186 10:22376731-22376753 CTGGCCACACAGACCAGCCCTGG - Intronic
1065121171 10:22531656-22531678 CTGGCCATTCAGAAGCACCCAGG + Intergenic
1067158390 10:43801860-43801882 CTGGCCACACAGCAAAATCCTGG - Intergenic
1068935602 10:62632817-62632839 CTGGCCAAACTGAAATGACCAGG + Intronic
1069771247 10:70901722-70901744 CTGGGCCCACAGAACTGCCCAGG + Intergenic
1069821180 10:71229639-71229661 CAGGCTAAACAGAAATTCCCTGG + Intronic
1070795510 10:79214179-79214201 CTGTCCACATAGAAAAACCAAGG - Intronic
1071959281 10:90794053-90794075 TTGGCAACACAGATACACCCAGG + Intronic
1077467143 11:2738757-2738779 CTGGCCACACAGACAGACCCTGG + Intronic
1077479828 11:2808317-2808339 CTGGCATCACAGAGCTACCCCGG + Intronic
1077936424 11:6792470-6792492 CTGGCCACTCTGAATAACCCGGG + Intergenic
1078539246 11:12200119-12200141 CTGAACACACAGAAATACAGAGG + Intronic
1078625265 11:12950064-12950086 ATTTCCACACAGAAAAACCCAGG + Intergenic
1079346978 11:19661458-19661480 CTGTACAAACAGAAAAACCCAGG - Intronic
1081236255 11:40650803-40650825 CTGGCCAAAGAGAACTACCATGG - Intronic
1082798219 11:57394114-57394136 CTGGTCACACTCAAAGACCCTGG - Intronic
1083858045 11:65403486-65403508 CTGTCCACATAGAAAGTCCCAGG - Intronic
1084163538 11:67364399-67364421 CTGGCAACCCACAGATACCCTGG + Exonic
1086676088 11:89608664-89608686 CTGGACACACAGACATCCCAGGG - Intergenic
1087639133 11:100736436-100736458 CTGGGCACACAGAAAATGCCTGG + Intronic
1087799699 11:102490103-102490125 CTGACCACACAGGAAAACTCTGG - Intronic
1089175228 11:116544055-116544077 ATGCCCTCACAGACATACCCAGG - Intergenic
1089396305 11:118138115-118138137 CTGGGCACACAGAACTCCCCAGG + Intronic
1089489194 11:118871323-118871345 CAGGCCACAGAAAAACACCCAGG + Intergenic
1089737553 11:120560408-120560430 CTGGCCACACAGCAGTGCTCTGG + Intronic
1091191068 11:133695644-133695666 CAGCCCACACAGACACACCCAGG - Intergenic
1091413281 12:258177-258199 CTGGCCAGAAAGAAATTCCTAGG + Intronic
1091541466 12:1466288-1466310 CTGGACATACAGAAAGACACTGG - Intronic
1096060326 12:48693087-48693109 CTGGCAATACAGACAAACCCCGG - Exonic
1097000276 12:55870743-55870765 ATGCCCACACAGACATACCCAGG - Intergenic
1097494534 12:60314112-60314134 CTGGCCATAAAGAAATTACCTGG + Intergenic
1100336367 12:93633937-93633959 CTGTCCCCACCCAAATACCCAGG + Intergenic
1100930370 12:99601941-99601963 CTGGCCACAAAGAAATACTCTGG - Intronic
1101063742 12:100998058-100998080 TTGGCCTCACAGACACACCCAGG - Intronic
1101282820 12:103277174-103277196 CAGGCCACACAGAAATTACAGGG - Intronic
1103332134 12:120161704-120161726 CTGGACACACTTAAATACCCAGG + Intronic
1104052743 12:125207093-125207115 CTGGCCAAACAGATATGCCCTGG - Intronic
1105515699 13:21088870-21088892 CTGGCAACATAGTAAGACCCTGG - Intergenic
1106183574 13:27388412-27388434 CTGGCCACCCAGCAAGTCCCTGG - Intergenic
1107458605 13:40578723-40578745 CTGGCCACACAGAATTAAACAGG + Intronic
1107650709 13:42541893-42541915 CTGACCACACAGAAAGAATCAGG + Intergenic
1111452173 13:88433798-88433820 CTGGCCATAAAGAAATACTCTGG - Intergenic
1112315826 13:98361294-98361316 CTGAACACACTGAATTACCCAGG + Intronic
1112493332 13:99885995-99886017 CTGGCCTCACAGCAGTTCCCAGG - Intronic
1112694943 13:101937414-101937436 CTGGACACACAGAGATCCCAGGG + Intronic
1113945818 13:114043573-114043595 CTTGCCACACAGACATACACAGG + Intronic
1115013744 14:28584108-28584130 CTTTCCACAAAGAAAAACCCAGG - Intergenic
1117410130 14:55442869-55442891 CTGGACACACAGAGACACCAGGG + Intronic
1118636500 14:67753028-67753050 CTCACCACACACAGATACCCTGG - Intronic
1119222019 14:72916444-72916466 GTGGGCACAGAGAAATACCAGGG + Intergenic
1119873951 14:78040818-78040840 CTGGTCACACAGACCAACCCTGG - Intergenic
1121310145 14:92931459-92931481 CTCCCCAGCCAGAAATACCCAGG + Exonic
1125311595 15:38385132-38385154 CTGGCCACCCAGAACTCCCTGGG + Intergenic
1126957522 15:53950720-53950742 CTGAAGACACAGAAATAGCCAGG + Intergenic
1129233991 15:74212906-74212928 CTGGCCACAAATAAATTCTCAGG + Intergenic
1130225615 15:82056293-82056315 CTGGCCACACAGAGAGAGGCGGG + Intergenic
1130603781 15:85296777-85296799 CAGTGCACACTGAAATACCCAGG - Intergenic
1131193961 15:90340193-90340215 CTGGCCACTCAAAAATACTGTGG + Intergenic
1131825931 15:96322581-96322603 CTGATCACACACAAATAGCCGGG - Intergenic
1131968944 15:97873472-97873494 TTGGACACACAGAGATACCAGGG - Intergenic
1132606761 16:796913-796935 CTGGCCACACAGGGATACAGTGG - Intronic
1132897047 16:2234042-2234064 CTGGACACCCAGAAGCACCCCGG - Intronic
1133782160 16:8947927-8947949 CTGGAGACAGAGAAATCCCCAGG - Intronic
1135695038 16:24578167-24578189 CTTGGCACACAGAAACACCTAGG - Intergenic
1135856687 16:26018152-26018174 CTGGCCACACAGAGATAAAAAGG - Intronic
1136674885 16:31893806-31893828 CTGCCCACACAGAGATTCTCAGG - Intronic
1137874937 16:51987130-51987152 CTGGACACACAGCCACACCCAGG + Intergenic
1139243972 16:65422683-65422705 CTGTCCTCACAGAATTATCCTGG - Intergenic
1140156421 16:72432225-72432247 CTGTCCACAAAGAAATCCCCAGG - Intergenic
1141636148 16:85314938-85314960 CTGACCTCACAGGAACACCCAGG + Intergenic
1142863966 17:2779332-2779354 CTGGCCACACAGAAATACCCCGG - Intronic
1146152165 17:30483612-30483634 CTGGACACAGATAAATGCCCAGG - Intronic
1147240220 17:39085928-39085950 CTGGCCACAGAGAAACTCCTGGG + Intronic
1147337690 17:39737455-39737477 CTGGCCCCTCAGAGGTACCCAGG - Intergenic
1147581701 17:41630834-41630856 CTGGCTCCCCAGAAATTCCCAGG - Intergenic
1147581718 17:41630900-41630922 CTGGCTCCCCAGAAATTCCCAGG - Intergenic
1147581735 17:41630966-41630988 CTGGCTCCCCAGAAATTCCCAGG - Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1150716814 17:67579216-67579238 CTGCCCAAACAGAAAGAGCCTGG - Intronic
1151600653 17:75104203-75104225 CTGGTCACACAGATGAACCCTGG - Intronic
1151673970 17:75588693-75588715 CTGGCCCCACGCAGATACCCGGG + Intergenic
1157415440 18:47498495-47498517 GTGACCACACAGCAATACACAGG - Intergenic
1157427096 18:47593501-47593523 TGGGCCACACAGAAATATCCTGG + Intergenic
1159088218 18:63818446-63818468 CTGGCCACAGGGAAGTACTCAGG + Intergenic
1159913412 18:74167218-74167240 CTGGGCACACAGAGACACCAGGG + Intergenic
1159957983 18:74533301-74533323 CTGGACACACACACATACACAGG + Intergenic
1160017049 18:75152684-75152706 CTGGAGACAAAGAAATACCACGG + Intergenic
1162991854 19:14308106-14308128 CTGGACAGACAGAAAGAACCTGG + Intergenic
1165403808 19:35618174-35618196 TTGGCGACACAGAGATATCCAGG + Exonic
1166458891 19:42968749-42968771 CTGGCCATACAGAAATTATCTGG - Intronic
1166634080 19:44434011-44434033 ATTGCTACAAAGAAATACCCAGG - Intronic
925783220 2:7403028-7403050 CTGGCCACACAGCTGTTCCCAGG - Intergenic
926003256 2:9351508-9351530 CCTGCCACACAGAACTACCTAGG - Intronic
927716989 2:25359520-25359542 CTGTCCACACAGAATTTCCCAGG + Intergenic
929088795 2:38194511-38194533 CTGGCCACAAAGAAATTATCTGG - Intergenic
929681032 2:43994096-43994118 CTGGCCTCACAGAAATGCTGAGG + Intronic
930211117 2:48638216-48638238 CTGGCCTCACAGAATTAGCTGGG - Intronic
930978860 2:57497460-57497482 CTGGCCATTCAGAATTAACCAGG - Intergenic
931103736 2:59031553-59031575 CTGGAGGCACAGAAATACACAGG + Intergenic
931457285 2:62421483-62421505 ATAGCCACACAAAAATACCTAGG + Intergenic
933049338 2:77583291-77583313 CTCCCCACAAAGCAATACCCAGG + Intronic
935061013 2:99607687-99607709 CTGTCCACACAGCAACAACCAGG - Intronic
936832899 2:116670732-116670754 CTGACCCCACAGAAATTCCAAGG + Intergenic
936910377 2:117585005-117585027 CTGACAACACAGAAATACAAAGG + Intergenic
937878300 2:126843473-126843495 TTGGCCACACAGGCAAACCCTGG + Intergenic
938635653 2:133223384-133223406 CTCCCCACACAGAAGTGCCCTGG + Intronic
940089381 2:149898728-149898750 TGGGACACACAGAAATACCAGGG + Intergenic
941354196 2:164468549-164468571 CTGCACACACAGACATACACAGG + Intergenic
943221165 2:185108045-185108067 CTGGTATCACAGAAATACACAGG + Intergenic
946381625 2:219352809-219352831 CTTTCCACACAGACAGACCCAGG - Intergenic
946457614 2:219840630-219840652 TTGGTCACACAGAATAACCCTGG - Intergenic
946467251 2:219922878-219922900 CTGGCCACACCAAAATCACCTGG + Intergenic
946498251 2:220218201-220218223 CTGGAAACCCATAAATACCCTGG - Intergenic
947950494 2:234142933-234142955 CTGGCATCACACAAATGCCCAGG - Intergenic
948127809 2:235577624-235577646 CTGCCCAAACAAAAATAACCGGG - Intronic
1169077673 20:2771434-2771456 CTGGCAACACAGCAATGCCATGG + Intergenic
1170973704 20:21140980-21141002 CTGGCGACAGAGCAAGACCCTGG + Intronic
1173452339 20:43175971-43175993 CTGGCAACAGAGAGAGACCCTGG + Intronic
1173452363 20:43176121-43176143 CTGGCAACAGAGAGAGACCCTGG + Intronic
1173720058 20:45250022-45250044 CTGGTGACACAGAAATACAAAGG + Intergenic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1178849906 21:36204506-36204528 CTGGGTACACAGCAAGACCCTGG - Intronic
1179936250 21:44606138-44606160 CTGGCAACAGAGCAAGACCCTGG + Intronic
1181133771 22:20750239-20750261 CTGGACACACAGAAATACTGGGG + Intronic
1182635461 22:31723079-31723101 CATGCAACACAGGAATACCCTGG + Intronic
1183178190 22:36239543-36239565 CCGGCCTCCCAGATATACCCTGG + Exonic
1184124843 22:42479790-42479812 CTGGCCATAAAGAAATTCTCTGG + Intergenic
1184133046 22:42529215-42529237 CTGGCCATAAAGAAATTCTCTGG + Intergenic
1184188114 22:42877951-42877973 CTGGCCACTCAGGATCACCCTGG - Intronic
1185267672 22:49912941-49912963 GTGGGCACAGAGAAAGACCCAGG + Intronic
950102602 3:10367162-10367184 CTGGCCCTGCAGAAATGCCCAGG + Intronic
950540583 3:13609922-13609944 CTGGCCAGAAAGAAATCCCTGGG - Intronic
951357886 3:21691207-21691229 TTGGCAACACAGAAACAACCTGG - Intronic
952395106 3:32914296-32914318 CTGGAGACAGAGCAATACCCCGG + Intergenic
955655431 3:61240303-61240325 CTGTACACACAGAAAGGCCCTGG - Intronic
959381657 3:105648351-105648373 CTGGACACACAGAGAAACACAGG + Intergenic
959405625 3:105958973-105958995 CTAGCAACACAGAAATACCTGGG + Intergenic
959509915 3:107199042-107199064 CTGGCCCCAGGGAAATATCCTGG - Intergenic
960725383 3:120664618-120664640 CTGGCAACATAGCAAGACCCTGG - Intronic
961397373 3:126604984-126605006 CTGGCCACACAGACCAGCCCTGG + Intronic
964183268 3:153913259-153913281 TTGGGCACACACAAAGACCCAGG + Intergenic
965001255 3:162957021-162957043 CTGGCCATAAAGAAATAATCTGG - Intergenic
966343063 3:178946751-178946773 CTGGCCCCAAAGAGATACTCAGG + Intergenic
966621141 3:181965120-181965142 TTGGTCACATAGAAATACCGAGG - Intergenic
966829107 3:183990572-183990594 CCTGCCACACAGAAAGAGCCTGG + Intronic
968893956 4:3388074-3388096 CTGGCCACGCAGAGATCCCCTGG + Intronic
969501550 4:7556502-7556524 CTGGACACATGGAAAGACCCAGG + Intronic
970531025 4:16983920-16983942 CTTTTCACACAGAAATATCCAGG + Intergenic
970640690 4:18062368-18062390 CTGGCAACATAGCAAGACCCTGG - Intergenic
970692083 4:18631274-18631296 TTGGCAAGAGAGAAATACCCTGG - Intergenic
975344149 4:73274964-73274986 CTGGCCCCACACAATTACTCAGG + Intergenic
976029582 4:80735941-80735963 CTGGCCTCTCAGAATTACCTTGG + Intronic
980000697 4:127484391-127484413 CTGACTTCCCAGAAATACCCTGG + Intergenic
980602515 4:135042427-135042449 ATGCCCTCACAGACATACCCAGG - Intergenic
981306260 4:143249660-143249682 CTGGCCATAAAGAAATTCCCTGG - Intergenic
981329586 4:143493102-143493124 ATAGCCACACATAAATACCTAGG + Intergenic
981639604 4:146925542-146925564 ATGGCCACACAGAAGTACAAAGG - Intronic
981956827 4:150485559-150485581 CTGGACACAGAGACATACACAGG + Intronic
982341121 4:154300157-154300179 CTTGCCACATACAAACACCCAGG - Intronic
986323796 5:6656228-6656250 CTGGCAACACTAAAATAGCCAGG - Intronic
986444404 5:7808625-7808647 CTGGACAGACAGATACACCCAGG - Intronic
987321556 5:16774930-16774952 CAAGCCCCACAGATATACCCAGG + Intronic
987626723 5:20411789-20411811 CTGCCCACAAAAAAATACCTAGG + Intronic
988468014 5:31509594-31509616 CGGGCCACACGGAAAAACACTGG + Intronic
993458397 5:88152554-88152576 CTTGCAACTCAGAAATACCAGGG - Intergenic
993834056 5:92794974-92794996 CTCCCCACAAAGAAATGCCCAGG - Intergenic
998079607 5:139263578-139263600 TTGGTCACACAGACAAACCCTGG - Intronic
1002075263 5:176704754-176704776 CTGGCCACACAGATAGAAGCAGG + Intergenic
1002413074 5:179099385-179099407 CTGGCCACAAAGAAAAGCCTGGG + Intergenic
1005935160 6:30515595-30515617 CTGGCCTCACAGACTTGCCCAGG + Intergenic
1006978977 6:38131124-38131146 CTGACAACACAGAAATACAGAGG - Intronic
1008336025 6:50305890-50305912 TTGGCCATACAGACAAACCCTGG - Intergenic
1012258607 6:97061832-97061854 CTGGCCAAACACAAATTCCCTGG + Intronic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1014432871 6:121390276-121390298 CTGGCCACACTGACAGGCCCTGG + Intergenic
1014744408 6:125183102-125183124 CTGGCCACACTGAAATCTTCTGG - Intronic
1016376822 6:143429999-143430021 CTGCCCTCTCAGAAATCCCCAGG + Intronic
1017727677 6:157286961-157286983 CAGGGCACACAGAAATATCTTGG - Intergenic
1018466822 6:164054870-164054892 CTTTCCACAAAGAAATCCCCAGG - Intergenic
1018879110 6:167858042-167858064 CTACCCACACAGACATACACTGG - Intronic
1019385447 7:753200-753222 CAGGCCACACAGACTTGCCCTGG + Intronic
1020576660 7:9940469-9940491 ATACCCACACAGACATACCCAGG - Intergenic
1022614998 7:31920259-31920281 CTGGACACACAGATATCTCCAGG + Intronic
1023574535 7:41612098-41612120 CTGGCCACGGAGAAGTACACAGG + Intergenic
1023866463 7:44240706-44240728 CTGGCCACACGGAATTTCTCAGG - Exonic
1024934586 7:54699476-54699498 ATGTCCTCACAGAAACACCCAGG + Intergenic
1026668186 7:72362697-72362719 CGGGCCACAGAGGAATATCCTGG - Intronic
1030346710 7:108442104-108442126 CTGCCCATACAGTAATACCTTGG + Intronic
1031088497 7:117325171-117325193 CTGGCCACTCACTAATTCCCTGG - Intergenic
1031091010 7:117354381-117354403 CTTCCCACACAGAAAAACGCAGG + Intergenic
1032067404 7:128782106-128782128 CTGGGCACACAGAAATGCCTGGG + Intergenic
1032260520 7:130332406-130332428 CCGGGACCACAGAAATACCCTGG - Intergenic
1032589969 7:133182960-133182982 CTGCCCACACAGTAATGCTCAGG + Intergenic
1034742486 7:153490234-153490256 CTGGCCTCATAGAAATAGCTAGG - Intergenic
1036180427 8:6579884-6579906 CTGCCCACACAGAACTGGCCTGG + Intronic
1037070952 8:14648252-14648274 CTAGCCAGACAGAGATACCTTGG - Intronic
1041023235 8:53658819-53658841 TTGGCTACCCAGAAAGACCCTGG + Intergenic
1042013702 8:64283148-64283170 CTGGCCTCACAGAAACAGTCAGG - Intergenic
1042215068 8:66423048-66423070 CTGGCCATAAAGAAATTCTCTGG + Intergenic
1044481153 8:92690180-92690202 CTTTCCACAAAGAAAAACCCAGG - Intergenic
1048219172 8:132525811-132525833 CTGGCGACACAGATAAAGCCAGG + Intergenic
1050043659 9:1521343-1521365 CTGACCCCACAGCAGTACCCAGG - Intergenic
1053039454 9:34857358-34857380 TTGGGCACACAGGAAGACCCAGG - Intergenic
1054763618 9:69024874-69024896 CTGGTCACACAGACCAACCCTGG + Intergenic
1056067100 9:82947786-82947808 CTGCCCCAGCAGAAATACCCAGG + Intergenic
1056699350 9:88889140-88889162 CTGGCCACACACAAAAACAACGG + Intergenic
1057961925 9:99465326-99465348 CTGGCCACGCAAAAATCTCCTGG + Intergenic
1059062752 9:111050821-111050843 CTGGGGAGACAGAAAGACCCTGG + Intergenic
1060029617 9:120203127-120203149 CAGGCCTCACATAAATACCTGGG + Intergenic
1060796766 9:126517185-126517207 CGGCACAAACAGAAATACCCCGG + Intergenic
1061196530 9:129110028-129110050 CTGGCCACACACAATTCCCCAGG + Intronic
1061805189 9:133133782-133133804 CTGGCCACACACACAAGCCCAGG + Intronic
1062104881 9:134749913-134749935 CTGGCCACACAGACATACCTAGG - Intronic
1062398638 9:136362937-136362959 AAGGCCACCCAGAAGTACCCTGG - Intronic
1062477037 9:136733378-136733400 CAGGCAACATAGAAAGACCCTGG + Intergenic
1062732413 9:138117544-138117566 CTTGCCACACAGGACTATCCTGG - Intronic
1186185457 X:7015876-7015898 CTGGCCATACAGAAATTATCTGG - Intergenic
1186602680 X:11055161-11055183 CTGGGCACTCAGTAATAACCTGG - Intergenic
1186979072 X:14939702-14939724 TTGGCTACACAGAATTACCTGGG - Intergenic
1192527117 X:71856664-71856686 ATTGCCACACAGACATACCCAGG - Intergenic
1194646282 X:96462700-96462722 CTACCCTCACAGAAACACCCAGG - Intergenic
1195563982 X:106321325-106321347 CTTCCCACAAAGAAAAACCCAGG + Intergenic
1197109116 X:122751489-122751511 CTCCCAACAAAGAAATACCCTGG - Intergenic
1200975234 Y:9205230-9205252 CTTGGCACACTGAAATCCCCTGG - Intergenic