ID: 1142864856

View in Genome Browser
Species Human (GRCh38)
Location 17:2784656-2784678
Sequence CGCCTACTCTCATGTAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142864845_1142864856 17 Left 1142864845 17:2784616-2784638 CCCTGGCCACAGGTGAGGCTTGG 0: 1
1: 0
2: 2
3: 17
4: 263
Right 1142864856 17:2784656-2784678 CGCCTACTCTCATGTAGTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 26
1142864849_1142864856 11 Left 1142864849 17:2784622-2784644 CCACAGGTGAGGCTTGGGTCTGT 0: 1
1: 0
2: 0
3: 19
4: 188
Right 1142864856 17:2784656-2784678 CGCCTACTCTCATGTAGTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 26
1142864847_1142864856 16 Left 1142864847 17:2784617-2784639 CCTGGCCACAGGTGAGGCTTGGG 0: 1
1: 0
2: 1
3: 31
4: 351
Right 1142864856 17:2784656-2784678 CGCCTACTCTCATGTAGTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 26
1142864844_1142864856 18 Left 1142864844 17:2784615-2784637 CCCCTGGCCACAGGTGAGGCTTG 0: 1
1: 0
2: 2
3: 25
4: 279
Right 1142864856 17:2784656-2784678 CGCCTACTCTCATGTAGTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142864856 Original CRISPR CGCCTACTCTCATGTAGTCC AGG Intronic
907756171 1:57312960-57312982 CGCTTGCTCTCATGAAGCCCTGG + Intronic
917840927 1:178976811-178976833 CGCCAACCCTGATGTAGTTCTGG - Intergenic
922507656 1:226135882-226135904 AGCCTCCTCTCTTGTAGTCCGGG - Intergenic
1078552144 11:12288311-12288333 ACCCTACACTCATATAGTCCGGG - Intronic
1079955225 11:26853895-26853917 AGCCTAGTTTCATGTAGTTCAGG + Intergenic
1090483298 11:127086774-127086796 CACCTACTCTCATGGAGTTTAGG + Intergenic
1102302758 12:111782938-111782960 CCCCTCCTTTCATGAAGTCCTGG - Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1114388332 14:22278986-22279008 CGCCTACTCTCAGGTTCTCGTGG - Intergenic
1130727820 15:86459303-86459325 GGCCTAATTTCATGTAGACCAGG + Intronic
1138107751 16:54298782-54298804 CGCCTACTCTCTTTGAGTACGGG + Intergenic
1142864856 17:2784656-2784678 CGCCTACTCTCATGTAGTCCAGG + Intronic
1149626941 17:58086155-58086177 TGCCTTCTCTCAAGTACTCCAGG - Intronic
1151996395 17:77611992-77612014 TGCCTGCTCACATGAAGTCCGGG - Intergenic
1155055196 18:22176620-22176642 CCCCTACTCTCAGGCTGTCCCGG - Intronic
940267726 2:151857642-151857664 GGCTTGCTCACATGTAGTCCTGG - Intronic
952408976 3:33030391-33030413 CACCTGCTCTCTTGTAGTACTGG - Intronic
955199951 3:56842617-56842639 CCCCTACAATCATGTAGCCCTGG + Intronic
959510464 3:107205194-107205216 CTCCTACCCTCAAGTAGGCCTGG - Intergenic
977918870 4:102622462-102622484 CACCTCCTCTCATGTTGTGCTGG + Intergenic
994195028 5:96913663-96913685 AGCCTTCTCTCATTCAGTCCAGG + Intronic
1001356288 5:171026885-171026907 CACCTCCTGCCATGTAGTCCAGG - Intronic
1001996815 5:176168256-176168278 TGCTTAATCTCATCTAGTCCAGG + Intergenic
1003069347 6:2932410-2932432 AGCCTCCTCTCATGTAACCCTGG - Intergenic
1007803234 6:44416096-44416118 GGCCTCCTCTGATGTAGTCTAGG + Intronic
1045186957 8:99848010-99848032 CCCCTACCCTCAGGTAATCCTGG + Intronic
1051038598 9:12778814-12778836 AGCCTAATGTCAGGTAGTCCAGG + Intronic
1058378709 9:104355218-104355240 TACCTACTGTCATGTGGTCCAGG - Intergenic