ID: 1142866461

View in Genome Browser
Species Human (GRCh38)
Location 17:2794468-2794490
Sequence GCTGCTGGCTTCCCACAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142866461_1142866471 24 Left 1142866461 17:2794468-2794490 CCATCCTGTGGGAAGCCAGCAGC 0: 1
1: 0
2: 4
3: 35
4: 282
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151
1142866461_1142866470 23 Left 1142866461 17:2794468-2794490 CCATCCTGTGGGAAGCCAGCAGC 0: 1
1: 0
2: 4
3: 35
4: 282
Right 1142866470 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 120
1142866461_1142866472 25 Left 1142866461 17:2794468-2794490 CCATCCTGTGGGAAGCCAGCAGC 0: 1
1: 0
2: 4
3: 35
4: 282
Right 1142866472 17:2794516-2794538 ACACAATCCTAACTTTCCTGGGG 0: 1
1: 0
2: 2
3: 36
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142866461 Original CRISPR GCTGCTGGCTTCCCACAGGA TGG (reversed) Intronic