ID: 1142866462

View in Genome Browser
Species Human (GRCh38)
Location 17:2794472-2794494
Sequence TCAGGCTGCTGGCTTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142866462_1142866473 27 Left 1142866462 17:2794472-2794494 CCTGTGGGAAGCCAGCAGCCTGA 0: 1
1: 0
2: 3
3: 29
4: 236
Right 1142866473 17:2794522-2794544 TCCTAACTTTCCTGGGGCAGAGG 0: 1
1: 0
2: 3
3: 17
4: 263
1142866462_1142866472 21 Left 1142866462 17:2794472-2794494 CCTGTGGGAAGCCAGCAGCCTGA 0: 1
1: 0
2: 3
3: 29
4: 236
Right 1142866472 17:2794516-2794538 ACACAATCCTAACTTTCCTGGGG 0: 1
1: 0
2: 2
3: 36
4: 524
1142866462_1142866470 19 Left 1142866462 17:2794472-2794494 CCTGTGGGAAGCCAGCAGCCTGA 0: 1
1: 0
2: 3
3: 29
4: 236
Right 1142866470 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 120
1142866462_1142866471 20 Left 1142866462 17:2794472-2794494 CCTGTGGGAAGCCAGCAGCCTGA 0: 1
1: 0
2: 3
3: 29
4: 236
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142866462 Original CRISPR TCAGGCTGCTGGCTTCCCAC AGG (reversed) Intronic