ID: 1142866463

View in Genome Browser
Species Human (GRCh38)
Location 17:2794483-2794505
Sequence CTGGGGTGGCTTCAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 404}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142866463_1142866473 16 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866473 17:2794522-2794544 TCCTAACTTTCCTGGGGCAGAGG 0: 1
1: 0
2: 3
3: 17
4: 263
1142866463_1142866471 9 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151
1142866463_1142866470 8 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866470 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 120
1142866463_1142866479 27 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866479 17:2794533-2794555 CTGGGGCAGAGGTGAGGGTTGGG 0: 1
1: 2
2: 12
3: 93
4: 810
1142866463_1142866481 29 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866481 17:2794535-2794557 GGGGCAGAGGTGAGGGTTGGGGG 0: 1
1: 1
2: 18
3: 164
4: 1348
1142866463_1142866478 26 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866478 17:2794532-2794554 CCTGGGGCAGAGGTGAGGGTTGG 0: 1
1: 2
2: 20
3: 122
4: 963
1142866463_1142866475 21 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866475 17:2794527-2794549 ACTTTCCTGGGGCAGAGGTGAGG 0: 1
1: 0
2: 2
3: 53
4: 409
1142866463_1142866472 10 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866472 17:2794516-2794538 ACACAATCCTAACTTTCCTGGGG 0: 1
1: 0
2: 2
3: 36
4: 524
1142866463_1142866480 28 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866480 17:2794534-2794556 TGGGGCAGAGGTGAGGGTTGGGG 0: 1
1: 1
2: 10
3: 141
4: 1170
1142866463_1142866476 22 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866476 17:2794528-2794550 CTTTCCTGGGGCAGAGGTGAGGG 0: 1
1: 0
2: 1
3: 51
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142866463 Original CRISPR CTGGGGTGGCTTCAGGCTGC TGG (reversed) Intronic
900613801 1:3555359-3555381 CTGGCATGGCCTCAGGCCGCTGG + Intronic
900617903 1:3573529-3573551 CTGGGGCTGCTGCAGGCTGCAGG + Intronic
900623523 1:3598068-3598090 CTGTGGGGTCTGCAGGCTGCAGG - Intronic
900693012 1:3992999-3993021 CTGGGGTGCATTTAGGCTGGAGG + Intergenic
901024777 1:6273393-6273415 CAGGGGCAGCTTCAGGATGCAGG + Intronic
901871658 1:12142165-12142187 GCCGGGTGGCTTCAGGCTGATGG - Intronic
903436484 1:23353806-23353828 CTGGGGTGGTTTCAAACTCCTGG + Intergenic
903938169 1:26910928-26910950 CTGGGGAGGCCTCAGGGTGGTGG + Intronic
904063009 1:27725986-27726008 CGGCGGCGGCTGCAGGCTGCTGG - Intronic
904809413 1:33153470-33153492 GTGGGGTGGCTACTGGCTACTGG + Intronic
905294619 1:36946405-36946427 CAGTGGCTGCTTCAGGCTGCAGG + Intronic
906166197 1:43688250-43688272 GTGGGCTGGATTCAGCCTGCAGG + Intronic
906466149 1:46081589-46081611 CTGGGGTGGGGTTAGGCTGGGGG - Intronic
908816806 1:68043375-68043397 CTGTGGTGGCTGGAGGCTTCAGG - Intergenic
910257174 1:85259678-85259700 CTGGGGTGGCTTCCGGTTTCCGG - Intergenic
911032463 1:93504408-93504430 CTGGGGAGGCTTCAGACTCATGG - Intronic
911364981 1:96927291-96927313 CCTGGGTGGCTTCAAGCTGGGGG - Intergenic
914944096 1:152048350-152048372 CTGGAGTGGCTAGAGGCTGCTGG + Intergenic
915081510 1:153355737-153355759 CAGGGTTGGCTGCTGGCTGCTGG + Intergenic
915166134 1:153948726-153948748 CTGGGGTGGATGAAGGTTGCTGG - Intronic
915821874 1:159032558-159032580 CTGGGGTAGCTTCATGCTCTTGG - Exonic
916056937 1:161074407-161074429 CTGGGGTGGGTTGTGGCTGCAGG - Intronic
917978398 1:180254514-180254536 CTGGCGTGGCTGCAGGGTGGTGG + Intronic
918048075 1:180953367-180953389 CTGGGGCCCCTTGAGGCTGCGGG - Intergenic
919796051 1:201322221-201322243 TAGGGCTGGCTTCAGGCTCCAGG - Intronic
920508623 1:206534588-206534610 CAGGGAGGGCTTCAGGGTGCAGG - Intronic
920854385 1:209651401-209651423 CGGGGCTGGGTTGAGGCTGCTGG - Intronic
921324082 1:213973464-213973486 CTGGGGTGGCCTCTTGCTGCTGG - Intergenic
922170387 1:223149645-223149667 CTGTGGCAGCTTCAGGCTTCTGG + Intergenic
922554705 1:226523845-226523867 CTGGGGTGGCCTGCGGATGCAGG + Intergenic
1063221802 10:3975717-3975739 CTGAGGGGGTGTCAGGCTGCTGG + Intergenic
1063366260 10:5492824-5492846 GTGGGGGTGCTTCAGGCAGCAGG - Intergenic
1063614985 10:7593402-7593424 GCTGGGTGGCTGCAGGCTGCAGG - Intronic
1063615004 10:7593468-7593490 GCTGGGTGGCTGCAGGCTGCAGG - Intronic
1063615023 10:7593534-7593556 GCTGGGTGGCTGCAGGCTGCAGG - Intronic
1063615033 10:7593567-7593589 GCTGGGTGGCTGCAGGCTGCAGG - Intronic
1063615043 10:7593600-7593622 GCTGGGTGGCTGCAGGCTGCAGG - Intronic
1063615053 10:7593633-7593655 GCTGGGTGGCTGCAGGCTGCAGG - Intronic
1063615063 10:7593666-7593688 GCTGGGTGGCTGCAGGCTGCAGG - Intronic
1063615072 10:7593699-7593721 GCTGGGTGGCTGCAGGCTGCAGG - Intronic
1063615095 10:7593797-7593819 GTTGGGTGGCTGCAGTCTGCAGG - Intronic
1065281340 10:24141769-24141791 CCTGGTTGGGTTCAGGCTGCTGG - Intronic
1065907652 10:30272380-30272402 CTAGGTTGACTTCAGACTGCTGG - Intergenic
1067228484 10:44390643-44390665 CTTGGGTAGCTTCAGGATGGAGG - Intergenic
1067427520 10:46221103-46221125 CTGGGTAGGCTGCAGGCAGCAGG + Intergenic
1069599408 10:69693823-69693845 CTGGGGTGGTTCCAGGATGGAGG - Intergenic
1069709036 10:70477752-70477774 CTGGGGTTGCCCCAGGATGCAGG - Intergenic
1069755408 10:70771780-70771802 CAGGGGTGGCAGCAGGCTGGAGG - Intronic
1069858039 10:71452343-71452365 CTCGGGAGGCTTCTGGCTGCGGG - Intronic
1070721446 10:78760046-78760068 CTGGGGTGGCTTGAGGCCTGAGG - Intergenic
1070818113 10:79338002-79338024 CTCGGGTGGCTGCAGTCTGATGG + Intergenic
1070827687 10:79400757-79400779 ACTGGCTGGCTTCAGGCTGCTGG + Intronic
1072618033 10:97062702-97062724 CTGGGGGAGCTGCAGGCAGCAGG + Intronic
1072626233 10:97114004-97114026 CTGGAGTGGCTTCAGGCACCTGG - Intronic
1072808954 10:98445139-98445161 TGGGGGTGGCCTCAGGATGCAGG + Intronic
1073084901 10:100882046-100882068 CTGGGGAGGCTTCTGGGTTCTGG + Intergenic
1073440133 10:103547603-103547625 TTGGGGTGGCTTCAGCTAGCTGG + Intronic
1074327591 10:112467542-112467564 CTGGGCTGCCTGCAGCCTGCTGG + Intronic
1074528634 10:114281530-114281552 CTTGGGTGGCTTCCACCTGCTGG - Intronic
1074974498 10:118569145-118569167 CTGGGCTGGCTTCAGGGTCCAGG - Intergenic
1075122904 10:119677201-119677223 CTGCTGTGGCTTCTGGCTGCTGG - Exonic
1075941579 10:126394726-126394748 CTGGGGTGGATGGAGGCTGGGGG + Intergenic
1076202039 10:128566672-128566694 CTGGGGTGCCTTGTGGCTTCCGG + Intergenic
1076289581 10:129334806-129334828 CTGGGGTGGCCTCTTGCTGGAGG - Intergenic
1076338345 10:129725670-129725692 CTGGGCAGGCTACAGCCTGCAGG + Intronic
1076535628 10:131174939-131174961 TTGGGGTGGGTTCAGGCTGCAGG - Intronic
1076582122 10:131518744-131518766 CAGGGCTGTCTTCCGGCTGCGGG - Intergenic
1076631647 10:131855544-131855566 CTGTGCTGGCCTCAGGGTGCTGG + Intergenic
1077027243 11:446370-446392 CTGCAGGGGCTTCAGGCTGGGGG - Intergenic
1077201235 11:1308845-1308867 CTGGGGGGCCATCAGGGTGCGGG + Intronic
1077201263 11:1308916-1308938 CTAGGGTGCCATCAGGGTGCGGG + Intronic
1077216934 11:1398869-1398891 CTGGGGGGGCTCCAGGCTCCAGG - Intronic
1077373529 11:2194785-2194807 CTGGGGTGAGCTCAGGGTGCAGG - Intergenic
1078167212 11:8897981-8898003 CTGGGCTGGCCTCAAGCTGTTGG + Intronic
1079027192 11:16958924-16958946 CTGGGGTGGGTACAGGCGGGTGG + Intronic
1080639943 11:34152719-34152741 CAGAGGTGGCCTCAGGATGCAGG - Intronic
1082842165 11:57698716-57698738 CTGGGCTGACTTGAGGCTGGAGG - Exonic
1083330709 11:61897162-61897184 GTGGGGTGGCTTCAGGATTTGGG + Intergenic
1085316528 11:75548428-75548450 CTGGGTTGGGTGCTGGCTGCCGG + Intergenic
1085485413 11:76859666-76859688 CTGGGATGGCTTCAGAGAGCTGG + Intergenic
1086001059 11:81986785-81986807 GTGGGGAGGGCTCAGGCTGCAGG + Intergenic
1088166142 11:106939893-106939915 CTGGGGATGATTAAGGCTGCAGG - Exonic
1088687952 11:112300319-112300341 CTGGGGAGGCTGCAGGGAGCTGG + Intergenic
1089196732 11:116697887-116697909 CTGGGGCTGCTGGAGGCTGCTGG - Intergenic
1089687870 11:120168560-120168582 CTGGGGCGGCTTCAGGGAGTAGG + Intronic
1090205014 11:124879281-124879303 CTGAGGTGGGGTGAGGCTGCAGG - Exonic
1090334698 11:125954583-125954605 CTTGGGAGGCTCCAGGCTGAGGG + Intergenic
1091961522 12:4699156-4699178 CCTGAGTGGCTTCAGGCTGGGGG - Intronic
1094377113 12:29801964-29801986 CTGGGGGCGCTGCAGGCGGCCGG + Intergenic
1094549368 12:31436089-31436111 GTGGGGGGGCTTTAGGCAGCTGG - Intronic
1095674238 12:44897888-44897910 CCAGGTTGGCTTCAGACTGCTGG - Intronic
1095857995 12:46882479-46882501 ATGGGGTGGGGTCATGCTGCAGG - Intergenic
1095914483 12:47463097-47463119 ATGGGGTTGCTCCAGGCTGACGG - Intergenic
1097907148 12:64931973-64931995 GCGGGGTGATTTCAGGCTGCAGG + Intergenic
1101641348 12:106587380-106587402 TTGGGGTGACTTCAGGGGGCGGG + Intronic
1102020635 12:109679899-109679921 CTGGGAGGCCTCCAGGCTGCAGG + Intergenic
1103118758 12:118362419-118362441 CTGGGGTGCATGCAGCCTGCGGG + Intronic
1104162426 12:126192674-126192696 CTGGGTTGGCTTCTTGCTGCTGG + Intergenic
1104824667 12:131700598-131700620 CTAGGGTGGAAGCAGGCTGCTGG - Intergenic
1104914289 12:132256827-132256849 CTGGGGTGGCTGAAAGGTGCAGG - Intronic
1104960126 12:132484598-132484620 CTGGTGTGGGGTCAGGCTGTGGG - Intergenic
1105214787 13:18277818-18277840 CTGGGACCGCTGCAGGCTGCAGG + Intergenic
1105774644 13:23646220-23646242 TTGGGGGGGCTTCAGGGTGGAGG - Intronic
1106125709 13:26898404-26898426 CTTGGGTGGCTCCTGGCTGGAGG + Intergenic
1106304708 13:28499008-28499030 CTTGGGTTGACTCAGGCTGCAGG + Intergenic
1106561177 13:30847738-30847760 CTGGGGTGGAGGCTGGCTGCTGG - Intergenic
1108139883 13:47409258-47409280 CTGAGGTGGTTCCAGGATGCAGG - Intergenic
1108581902 13:51834903-51834925 CCAGGGTGGCAGCAGGCTGCAGG + Intergenic
1108747371 13:53409167-53409189 CTGGTGTGTCAGCAGGCTGCCGG + Intergenic
1111777054 13:92677757-92677779 GTGGGGTGGCGTCAGGTTTCAGG - Intronic
1114549507 14:23524923-23524945 CTGGGGGAGCCTCCGGCTGCAGG - Exonic
1116861490 14:49999267-49999289 CTGGGGTGGCTGCAGGGAGGTGG - Intronic
1117294956 14:54370782-54370804 CTGGGTGGGCTTCAGGATGTTGG - Intergenic
1117344061 14:54815635-54815657 TTGGGGTGGCATCAGGAAGCAGG - Intergenic
1120218999 14:81711684-81711706 CTGGGGTGGCTTCATCTTGAAGG + Intergenic
1120243506 14:81978147-81978169 CTGAGCTGGTTTCAGACTGCAGG - Intergenic
1121820175 14:96959550-96959572 CAGGGCTGGTATCAGGCTGCTGG + Intergenic
1122020149 14:98831126-98831148 CTGGGCCGGCTTCTGGCAGCCGG - Intergenic
1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG + Intronic
1122316948 14:100831346-100831368 CCTGGGAGGCTCCAGGCTGCCGG - Intergenic
1122572073 14:102711400-102711422 CTGGGGTGACTGCAGGGAGCTGG + Intronic
1122715404 14:103693880-103693902 CTGAGGTGGCTTCAGCACGCTGG + Intergenic
1122789365 14:104177863-104177885 CTTGGGGGACTTGAGGCTGCGGG - Exonic
1122881513 14:104692497-104692519 CTGGGGTAGGCTCAGGGTGCTGG + Intronic
1123013014 14:105358252-105358274 GTGGGGTGGCTTAGGTCTGCAGG + Intronic
1123703832 15:22936573-22936595 CTGGAGCGTCATCAGGCTGCAGG + Intronic
1123938056 15:25203491-25203513 CTGGGGGCGGTTCAGGTTGCTGG + Intergenic
1124192187 15:27589453-27589475 CTGGGGTGGCCTCCTGCGGCCGG + Intergenic
1127391108 15:58505860-58505882 CTGACGTGGCTGCAGGTTGCTGG + Intronic
1128093667 15:64936336-64936358 CTGGGCTGGCATCAGGATTCTGG - Intronic
1128526332 15:68414801-68414823 ATGGGGGGGCTTGAGGCTGAGGG - Intronic
1128935456 15:71742582-71742604 CTGGCTGGGCTTCAGGCAGCAGG - Intronic
1128946061 15:71822065-71822087 CTGTAGTGGATGCAGGCTGCTGG - Intergenic
1129394074 15:75234806-75234828 GTGCAGTGGCTTCTGGCTGCTGG - Intergenic
1129755323 15:78094575-78094597 CTGGGGGAGCTGCAGGGTGCTGG + Intronic
1129755328 15:78094594-78094616 CTGGGGGAGCTGCAGGTTGCTGG + Intronic
1130272166 15:82457712-82457734 CTGTGGTGGCTCCATTCTGCAGG + Intergenic
1130464518 15:84185065-84185087 CTGTGGTGGCTCCATCCTGCAGG + Intergenic
1130488169 15:84409739-84409761 CTGTGGTGGCTCCATCCTGCAGG - Intergenic
1130499749 15:84488472-84488494 CTGTGGTGGCTCCATCCTGCAGG - Intergenic
1130586810 15:85189679-85189701 CTGTGGTGGCTCCATCCTGCAGG + Intergenic
1132146776 15:99433823-99433845 CTGGGGGGGCTCCAGCCTGTGGG + Intergenic
1132547660 16:540663-540685 CTGGGGTCGCTGGCGGCTGCAGG + Intronic
1132941674 16:2511613-2511635 GTGGCGTGACGTCAGGCTGCGGG + Intronic
1133412802 16:5582214-5582236 CTGGGGTAGCGACAGGCTGGTGG + Intergenic
1134502407 16:14779595-14779617 CTGGGGTGGCATCAGTGGGCTGG + Intronic
1134578157 16:15349299-15349321 CTGGGGTGGCATCAGTGGGCTGG - Intergenic
1134724434 16:16408247-16408269 CTGGGGTGGCATCAGTGGGCTGG + Intergenic
1134942997 16:18303612-18303634 CTGGGGTGGCATCAGTGGGCTGG - Intergenic
1136477319 16:30521607-30521629 ATGGAGGGGCTTCAGGCAGCCGG - Exonic
1137262752 16:46844471-46844493 CAGGGGTGGCTTCGCGCTGGAGG - Intergenic
1137746320 16:50822875-50822897 CTGGAGTGGCTTCAGACGGAGGG + Intergenic
1137811720 16:51359128-51359150 CTGGGCTGGCCTCCTGCTGCTGG + Intergenic
1138414444 16:56863396-56863418 CTGGGATGGCTTCAGGAGCCAGG + Intergenic
1138531541 16:57637115-57637137 ATGGGGTGGCGTAAGGCTGGGGG + Intronic
1139448717 16:67014219-67014241 CTGGGCTGGCGCCAGGCGGCTGG - Intergenic
1140930000 16:79618770-79618792 CTGGGGAGGCTTCATGGTTCAGG - Intergenic
1141091474 16:81133261-81133283 CTGGGGTGGGGACAGGGTGCAGG + Intergenic
1141605383 16:85150185-85150207 TTGGGGTAGCTGCAGGCTGTGGG - Intergenic
1142112075 16:88338288-88338310 CTGAGCTGGGTCCAGGCTGCGGG + Intergenic
1142866463 17:2794483-2794505 CTGGGGTGGCTTCAGGCTGCTGG - Intronic
1143497837 17:7322614-7322636 CTGGGGTAGCTGCCGGCTCCAGG - Intronic
1143781607 17:9232251-9232273 CTGGGGTGCCCTCGGGATGCAGG - Intronic
1143865335 17:9918984-9919006 CAGGGGTGGCTTTAGGCAGTGGG + Intronic
1143919407 17:10318948-10318970 CTGCTGTGGCTTCGTGCTGCAGG + Exonic
1143933113 17:10452099-10452121 CTGCCGTGGCTTCGTGCTGCAGG + Exonic
1145262767 17:21364662-21364684 CTGTGGAGGCTTCAGGGAGCTGG + Intergenic
1146401037 17:32500180-32500202 CTGGGGCCGCGTAAGGCTGCAGG + Intronic
1146810690 17:35900561-35900583 CCAGGGTGGCTTCAGGATGCAGG - Intergenic
1147928695 17:43962577-43962599 CAGGGGTGCCCTCAGACTGCCGG + Intronic
1148489603 17:48014560-48014582 CAGGGGTGGAGTCAGGGTGCTGG - Intergenic
1150435010 17:65146983-65147005 CTGAGGAGGCAACAGGCTGCAGG - Intronic
1151233410 17:72701029-72701051 TTGGTGGAGCTTCAGGCTGCAGG - Intronic
1151692936 17:75698144-75698166 CCGGGGTGGCCCAAGGCTGCGGG + Intronic
1151771183 17:76163127-76163149 ATGGGGTGGCTTCATGGTGTGGG - Intronic
1151993170 17:77591659-77591681 CTGGGGACACTGCAGGCTGCTGG + Intergenic
1152193508 17:78902835-78902857 CTGGGGGGTCTTCAGGAAGCAGG - Intronic
1152224864 17:79088039-79088061 CCGGGCTGGCTCCAGGCTGCAGG - Intronic
1152234599 17:79132176-79132198 GTGAGGGGGCTTGAGGCTGCTGG + Intronic
1152252984 17:79221377-79221399 TTGGGGTGGCTGCAGGCGGGTGG + Intronic
1152496434 17:80675833-80675855 ATGTGGTGGATTCAGGCTCCAGG - Intronic
1152633688 17:81421797-81421819 CTGGGGTGGCCTCTTGCTTCTGG - Intronic
1152796579 17:82310547-82310569 CTGGGGTGGGGTCAGGCTGCCGG + Intergenic
1152800322 17:82327912-82327934 CTGGGGGGGCCGCTGGCTGCAGG - Intronic
1153110312 18:1578740-1578762 CTGGGGAGGCCTCAGGAAGCCGG - Intergenic
1153859082 18:9181516-9181538 CTGGGCTAGATTGAGGCTGCTGG - Intronic
1154070526 18:11148685-11148707 CTCGGGTGGCTGCGAGCTGCCGG - Intronic
1156027320 18:32669842-32669864 CTGGGCAGGCCTCAGGTTGCTGG + Intergenic
1157782271 18:50450008-50450030 CTAGGATGGCTTCAGGTTTCAGG + Intergenic
1159097739 18:63923516-63923538 CTGGGGAAGGTTCAGGGTGCAGG - Intronic
1160031255 18:75262000-75262022 CTGGTGTGACTTCAGAGTGCAGG + Intronic
1160044637 18:75375495-75375517 CTTGGGTGTCCTCTGGCTGCGGG + Intergenic
1160146191 18:76367157-76367179 CAGGTCTGGCTTCAGGCAGCTGG - Intronic
1160434817 18:78841609-78841631 CTGGGGTGGGTTGGAGCTGCTGG + Intergenic
1160571281 18:79819215-79819237 CTGGTGTCTCTGCAGGCTGCCGG - Intergenic
1160722714 19:604456-604478 CTGGGGTGGAGTCAAGCAGCAGG + Intronic
1160738953 19:677209-677231 CTGGGGTGGGGTGGGGCTGCAGG - Intronic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1161840750 19:6679023-6679045 ATGGTGTGGCTTCAGGCTGTGGG - Intronic
1161916323 19:7231064-7231086 CTGGTGTGGCTCCTGGCTCCTGG - Intronic
1162028805 19:7908751-7908773 CTGGGCTGGCAACAGGGTGCAGG - Intronic
1162511756 19:11123283-11123305 CAGGGGTGGCCCCAGGCAGCCGG - Exonic
1162547555 19:11339611-11339633 TCCGGGTGGCTGCAGGCTGCTGG - Exonic
1162796895 19:13091744-13091766 CTGGGCTGGCACCAGGCTTCAGG + Intronic
1163175859 19:15563725-15563747 CTGGGGTGGCTCCAGGGAGCTGG + Intergenic
1163182668 19:15615331-15615353 CTGGGATGGCTCCAGGGAGCTGG + Intronic
1163190441 19:15673201-15673223 CTGGGGTGGCTCCAAGATGCTGG + Intronic
1163202742 19:15780230-15780252 CTGGGGTGTCTCCAGGCTGCTGG - Intergenic
1163222905 19:15934717-15934739 TTGGGGTGGGTCAAGGCTGCTGG - Exonic
1163667179 19:18608680-18608702 CTGGGAGGACTTCAGGCTTCTGG + Intronic
1164734285 19:30529327-30529349 CAGGGGTGGTTTCAGACAGCTGG + Intronic
1164868862 19:31626812-31626834 CTGTGGTGGCTACAGGATGGAGG - Intergenic
1164876925 19:31697612-31697634 ATGGGGTGGGGTCAGGCTGAGGG + Intergenic
1165096654 19:33413381-33413403 CTGAGGTGGCCTCTGCCTGCAGG - Intronic
1165129508 19:33622926-33622948 CTGGGGCGGCTCCAGGGGGCGGG + Intronic
1165247309 19:34505005-34505027 CTGGGCTGGGTGGAGGCTGCAGG - Exonic
1165511560 19:36269268-36269290 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165512111 19:36271791-36271813 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165512659 19:36274290-36274312 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165513210 19:36276833-36276855 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165513765 19:36279386-36279408 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165514314 19:36281920-36281942 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165514868 19:36284459-36284481 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165515420 19:36286990-36287012 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165515970 19:36289528-36289550 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165516521 19:36292063-36292085 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165517073 19:36294591-36294613 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165517625 19:36297114-36297136 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165518178 19:36299649-36299671 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165518729 19:36302184-36302206 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165519277 19:36304714-36304736 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165519826 19:36307229-36307251 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165520379 19:36309760-36309782 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1166353867 19:42215794-42215816 CTGGGAGGGGTTCAGGCTGCCGG - Intronic
1166416294 19:42596629-42596651 CTGGGAAGGCTCCAGGCTGGAGG + Intronic
1167093018 19:47357784-47357806 CTGGGGAGGCTGCAGGCTGACGG - Intronic
1167461316 19:49625976-49625998 GTGGGGTGGCTTCAGAGAGCTGG + Exonic
1168046620 19:53798657-53798679 CTTGGGAGGCTTGAGGCTGGAGG + Intronic
1168092676 19:54095971-54095993 CTGGGCCGACTTCACGCTGCTGG - Exonic
1168290636 19:55355330-55355352 CTGGGAGTGCTGCAGGCTGCAGG + Exonic
926335571 2:11860111-11860133 CTGGGGTGGCTTCAGAATCATGG + Intergenic
926593106 2:14760371-14760393 CTGGGGTCGCCTCAGGCTCCCGG - Intergenic
927889322 2:26738562-26738584 GTGGGGTGACATCAGGCTGTGGG + Intergenic
928158211 2:28895227-28895249 CTGGGGCGGCTTCCTTCTGCCGG + Intronic
929543660 2:42841621-42841643 CTGGGAAGGCTGCTGGCTGCAGG + Intergenic
929564207 2:42974777-42974799 CTGGGCTGGGTTCAGCCTGTAGG - Intergenic
930003550 2:46878878-46878900 CTGGGTGGGCTACAGGCTGTAGG + Intergenic
930030521 2:47055772-47055794 CTGGGGTGGCCTCCAACTGCGGG - Intronic
933026525 2:77266751-77266773 CTGTTGGGGCTTCAGACTGCAGG + Intronic
934711851 2:96521334-96521356 CTGAGGTGGAATCAGGCGGCAGG - Intergenic
936060916 2:109295260-109295282 CTGCGGTGGCTCCAGGAAGCAGG + Intronic
936093955 2:109517685-109517707 CTGGGCTGGGTTCTGGCTGGAGG + Intergenic
936257240 2:110927371-110927393 CTGGGGTGCCTTCCACCTGCTGG + Intronic
937119791 2:119433204-119433226 CTGGGGAGGCCACAGGCTCCAGG + Intronic
938292452 2:130157304-130157326 CTGCTCTGGCTTCAGGCTGTTGG + Exonic
938383500 2:130849313-130849335 CTGGGGAGGCTTTAGGATGCAGG + Intronic
938464102 2:131515672-131515694 CTGCTCTGGCTTCAGGCTGTTGG - Intergenic
939372548 2:141320600-141320622 CTTGGGCAGTTTCAGGCTGCAGG - Intronic
942095208 2:172530746-172530768 CTGGGTTGGCAGCAGCCTGCCGG + Intergenic
944992443 2:205253539-205253561 CAGGGGAGGCTCCAGGCTGTGGG - Intronic
945072216 2:206003474-206003496 CTGGGATGACTGCAGGCTGCCGG - Exonic
947013315 2:225590043-225590065 CTGAGGTGGCTTCAGGTATCTGG - Intronic
947717550 2:232349506-232349528 TGGGGGTGGCTTCTGGCTGCAGG + Intergenic
948432669 2:237929957-237929979 CTGGGGTGGCTTGGGGGTGCTGG - Intergenic
948626926 2:239275172-239275194 CTGGGGTGGCTTCGGCCCACGGG - Intronic
948853769 2:240720778-240720800 TTGGGGTGGCCACAGGCTGAGGG - Intronic
948902542 2:240963807-240963829 CTGGGTGGGCAGCAGGCTGCAGG - Intronic
1168893811 20:1310430-1310452 CTGCAGTGGCTTCAGGCATCTGG + Exonic
1169102751 20:2965739-2965761 CAGGGGTGGCATCAGGCTCTGGG + Intronic
1169123458 20:3110979-3111001 GTGAGGGGGCTGCAGGCTGCAGG - Intronic
1171139578 20:22729331-22729353 CTGCTGTGGCTTCTGGCAGCAGG - Intergenic
1171458869 20:25287275-25287297 CTGTGGTGCCATCAGCCTGCAGG - Intronic
1173596412 20:44261250-44261272 ATGTGGTGGCTTCAGACTCCAGG - Intronic
1174056329 20:47800774-47800796 CTGGGGTTGGTTATGGCTGCTGG + Intergenic
1174068712 20:47884978-47885000 CTGCGGTGGATTCGGGCTGTGGG + Intergenic
1174306174 20:49615792-49615814 CTGGGGCGGCTCCTGGCTGCCGG - Intergenic
1174517921 20:51107353-51107375 AGGTGGTGTCTTCAGGCTGCAGG + Intergenic
1175410296 20:58763253-58763275 CGGGGGTGGGCTCAGGCTCCAGG - Intergenic
1175482294 20:59320373-59320395 CAGGTCTGGCCTCAGGCTGCGGG + Intronic
1175958605 20:62623844-62623866 CTGGGCTGGTCTCAGCCTGCAGG - Intergenic
1176157215 20:63627746-63627768 CTGGGGTGGGATCGGGGTGCCGG - Intergenic
1176157249 20:63627843-63627865 CTGGGGTGGGATCGGGGTGCCGG - Intergenic
1176157282 20:63627954-63627976 CTGGGGTGGGATCGGGGTGCTGG - Intergenic
1176219279 20:63962402-63962424 CTGGGGTGTCTTCTGGCCTCAGG - Intronic
1176973329 21:15290339-15290361 CTGGGGGGGCCTGAGGCAGCAGG + Intergenic
1179048273 21:37866444-37866466 CTTGGGTGGGCACAGGCTGCTGG + Intronic
1179480342 21:41672995-41673017 GTGGGGTGCCTGCAGGCCGCTGG - Intergenic
1179914153 21:44465342-44465364 GTGGGGTGGCTCAATGCTGCTGG + Intergenic
1180179684 21:46112370-46112392 CTGCGGGGGCATCAAGCTGCAGG + Exonic
1180855839 22:19044225-19044247 CTGGGCTGGCCTCTGGCTTCTGG - Intronic
1181111955 22:20607464-20607486 CTGCTCTGGCTTCAGGCTGTCGG + Intergenic
1181618992 22:24074981-24075003 CTGGGCTGGCTTCAAACTCCTGG - Intronic
1181697895 22:24603021-24603043 CTGGGACCGCTGCAGGCTGCAGG - Intronic
1181864050 22:25841222-25841244 CTCTGGGGGGTTCAGGCTGCTGG + Intronic
1182074877 22:27488554-27488576 CTTGGGTGGCATCTGGCTTCTGG - Intergenic
1182572243 22:31248210-31248232 CTGGGCTGGATCGAGGCTGCAGG - Intronic
1183613503 22:38927293-38927315 GTGGGTGGGATTCAGGCTGCCGG + Intergenic
1184190637 22:42892185-42892207 GTGGGGTGGCGTGAGGCTGGAGG + Intronic
1184444395 22:44539024-44539046 CTGGCCTGGGGTCAGGCTGCAGG - Intergenic
1184765420 22:46569636-46569658 CTGTGATGGCTTCTCGCTGCTGG + Intergenic
1185012673 22:48324023-48324045 CTGTGGGTGCTGCAGGCTGCAGG - Intergenic
1185161860 22:49234759-49234781 CTCTGCTGGCCTCAGGCTGCTGG - Intergenic
1185208529 22:49553870-49553892 CTGGGCTGGCTTCTTGCGGCAGG - Intronic
1185258372 22:49848915-49848937 CTGGGGTGGCCGCAGCCCGCGGG - Intergenic
1185307372 22:50127516-50127538 CTGGGATGGCTTCCAGCTCCGGG - Intronic
950504829 3:13388246-13388268 CTGGGGTGGAATCAGGCTGACGG - Intronic
950611226 3:14127948-14127970 CTGGGCTGGCACCAGGCTGGGGG - Intronic
952901420 3:38114350-38114372 CTGGGATGACTTCCGGCAGCAGG - Exonic
952970077 3:38645237-38645259 CTGGGCTGGCAGCAGGCTGTGGG + Intronic
953282150 3:41569339-41569361 CTAGGGTAGCTTCAGGATGGTGG - Intronic
953453148 3:43020709-43020731 CTGGGTTGGCTCCAGGCTGGAGG + Intronic
953810385 3:46107775-46107797 CTGAGGTTGCTGCAGGCTCCAGG + Intergenic
953909355 3:46883811-46883833 ATAGGGAGGCTTCAGGCAGCTGG - Intronic
953965651 3:47303630-47303652 CTAGGCTGGCTTCAAACTGCAGG + Intronic
954382860 3:50228789-50228811 CAGGAGTGACTTCAGGCTGTTGG - Intronic
955905487 3:63803487-63803509 CTGGTTTGGCTTCAGTCTGCAGG - Intergenic
956011092 3:64832386-64832408 CTAGGGTAGCTTCTGGCTTCGGG - Intergenic
961531361 3:127542308-127542330 CTGGGCTGACTTCAGGCTTTGGG + Intergenic
962301802 3:134250358-134250380 CTGGGGCAGCTTCCGGCCGCCGG - Intronic
963129427 3:141844751-141844773 GTGAGGTGGCTTCTGGGTGCTGG - Intergenic
965451888 3:168848168-168848190 CAGGGAGGGCTTCAGGGTGCTGG - Intergenic
965760121 3:172066512-172066534 CAGAGGTGGCTACAGGCTTCAGG + Intronic
967993687 3:195150926-195150948 ATGGCTTGGCTTCAGGCTTCAGG - Intronic
968110495 3:196042579-196042601 CTGGGGTGGCTTCCGGAAGCCGG - Intronic
968442351 4:630280-630302 CTGGGCTGGGGTCGGGCTGCTGG + Intronic
968506341 4:973027-973049 GTGGGGCCGCTCCAGGCTGCGGG - Intronic
968606817 4:1539410-1539432 CTGGGGGGGCTCCAGGCCCCTGG - Intergenic
968704086 4:2069995-2070017 CTGGGGTTCCTTCAGGGTCCTGG - Intergenic
969551058 4:7867437-7867459 CCAGGGTGGCTGTAGGCTGCAGG - Intronic
970437373 4:16048651-16048673 CTGGAGTGGCTTCTCCCTGCAGG + Intronic
971277561 4:25212468-25212490 CTGGGATGTGTGCAGGCTGCAGG + Intronic
971611594 4:28732252-28732274 CTGGGGTGCCTTCATGATTCTGG + Intergenic
973167083 4:47091574-47091596 CTGGGGTGGCTTCTAGCTGGAGG - Intronic
973582016 4:52353212-52353234 CTGGGGTGGCTCTAGAATGCAGG - Intergenic
973718718 4:53702544-53702566 CTGGGGTCTCCTGAGGCTGCAGG + Intronic
975803084 4:78083145-78083167 TTGAGGAGGCTTCATGCTGCAGG + Intronic
980451707 4:132981776-132981798 CTGGGTTGGCTTCAGACTTCTGG - Intergenic
986199745 5:5570154-5570176 CTGGGGTGGCAGCTGGCAGCTGG + Intergenic
988459092 5:31416570-31416592 CTGGTGTGACTTCTGGATGCGGG - Intronic
988509150 5:31851319-31851341 CTGGGGTGAATTCACGCTGGTGG - Intronic
988787585 5:34578976-34578998 CTGGAGTGGCCTGGGGCTGCAGG - Intergenic
989182822 5:38595604-38595626 CTGGGTTGGACTCATGCTGCTGG - Intronic
992181466 5:74202023-74202045 CTGGGTTGGTGACAGGCTGCTGG - Intergenic
995592859 5:113717656-113717678 AAGGGCTGCCTTCAGGCTGCTGG + Intergenic
997682007 5:135763433-135763455 CTGGGCTGGCTGGAGGGTGCTGG - Intergenic
997859650 5:137404985-137405007 CTGGGAGGACTTCAGCCTGCTGG - Intronic
999045180 5:148459489-148459511 CTTGGGTGGCTTAAGGGGGCTGG - Intronic
999062936 5:148654549-148654571 CTGGGCTGACTGCAGGCTCCTGG + Intronic
1000378310 5:160605087-160605109 ATGGGTTGGATTCAGCCTGCAGG + Intronic
1001591271 5:172867096-172867118 TTGGCTTGGCTTCAGGCTGTGGG + Intronic
1002334491 5:178468558-178468580 CTGAGCTGACCTCAGGCTGCAGG + Intronic
1002905130 6:1442233-1442255 CTGGGGAGGCCTCAGGCAGAAGG + Intergenic
1004165119 6:13249986-13250008 GTGGGGTGGGTTCAGTCTGTGGG - Intronic
1004329778 6:14710793-14710815 CTGGTGTGGCTTCTGTCTCCTGG - Intergenic
1006214664 6:32430113-32430135 CAGGGGTGCCTTGTGGCTGCAGG + Intergenic
1006373647 6:33659879-33659901 CTGGTGTGGATCCAGGCAGCAGG - Intronic
1006920725 6:37625485-37625507 CTGGGGAGGCTTGAAGCTGAAGG - Intergenic
1007558649 6:42787203-42787225 CAAGGGTGCCTTCAGGTTGCAGG + Intronic
1013536348 6:111066482-111066504 CTGGGGAGGCTCCAGGAAGCAGG - Intergenic
1015568154 6:134595083-134595105 CTGGGCTGGGTGCAGGGTGCTGG + Intergenic
1015883285 6:137891261-137891283 CTAGGTTGACTTCAGACTGCTGG + Intergenic
1017529873 6:155278931-155278953 CTGGGGTGAGTTTAGCCTGCAGG + Intronic
1018384471 6:163290512-163290534 CAGGGGTGGGGGCAGGCTGCGGG - Intronic
1019115221 6:169755299-169755321 CTGGGGAAGCGTGAGGCTGCTGG + Exonic
1019274374 7:168163-168185 GTGGGGGAGCTCCAGGCTGCCGG + Intergenic
1019492816 7:1323083-1323105 CTGCGATGGCTGCAGGCTCCGGG - Intergenic
1024046498 7:45589227-45589249 CCTGGGTGGCACCAGGCTGCTGG - Intronic
1027798573 7:82723689-82723711 TTGTGGTGGCTTTAGGCTGTTGG + Intergenic
1028500714 7:91516152-91516174 CTGGAGTTTCTTCAGGCAGCTGG + Intergenic
1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG + Intronic
1029593961 7:101526795-101526817 CTCCAGTGGCTTCAGGCTCCAGG - Intronic
1030124294 7:106139850-106139872 CAGGGTTGGCTTCAGTGTGCTGG + Intergenic
1031962262 7:128000691-128000713 TTGGAGTGTCTTCAGGCTTCAGG + Intronic
1034545373 7:151785618-151785640 CTGGGATGGGTTCTGGGTGCCGG - Intronic
1034550375 7:151816679-151816701 GGGGGCTGGCTGCAGGCTGCAGG - Intronic
1034999669 7:155602943-155602965 CTCGGGTGGCTTGAGTCTCCCGG + Intergenic
1036698326 8:10993871-10993893 ATGGGGTGGGCTGAGGCTGCAGG - Intronic
1037060113 8:14497451-14497473 CTGGGCTGCATTCAGCCTGCAGG - Intronic
1037807470 8:22066655-22066677 CCGGGGCGGCGTTAGGCTGCGGG - Intronic
1037813464 8:22099812-22099834 CCCCGGGGGCTTCAGGCTGCCGG - Exonic
1037914018 8:22761115-22761137 CTGGGGAGGCTCCAGGCTTTGGG - Intronic
1038584900 8:28779606-28779628 ATTGGGTGGCGTCAGGATGCAGG - Intronic
1038896371 8:31787021-31787043 CTTGGGTAGCTTCAGGATGGGGG - Intronic
1038996459 8:32928310-32928332 CTGGGGTGGGTTCTGGCCGCTGG + Intergenic
1039032857 8:33328653-33328675 CAGGGATGGCTTCGGGCTGGTGG - Intergenic
1039228203 8:35413437-35413459 CCATGGTGGCTTCAGGCTTCTGG - Intronic
1039612743 8:38932401-38932423 CTGGAGTCGGTTCAGGCTTCAGG + Intronic
1043346770 8:79307159-79307181 CTGGGGCAGCCTCAGGCTGGCGG + Intergenic
1045189281 8:99866908-99866930 CTGGGGTGGCCTGGGCCTGCCGG + Intronic
1045361666 8:101438677-101438699 GTGGGGAGGCTGTAGGCTGCAGG + Intergenic
1045482256 8:102601611-102601633 CTGTGGTGGCTGCTGGCTGAGGG - Intergenic
1045587886 8:103559770-103559792 CTGCCGTGGTTTCAGGATGCTGG + Intronic
1047181043 8:122588420-122588442 CTGGGGGGGCCTCAGGCTTCAGG - Intergenic
1047369903 8:124247513-124247535 ATTGGGTGGCTCCGGGCTGCAGG - Intergenic
1048634474 8:136280994-136281016 TTGTGGAGGTTTCAGGCTGCAGG - Intergenic
1048873068 8:138814668-138814690 CTGGGCTGCCCTCAAGCTGCTGG - Intronic
1048905470 8:139084007-139084029 CTGTGGTGGCTTCAGGGAGGAGG - Intergenic
1049283226 8:141761124-141761146 CTGGGCTGGGTTCTGCCTGCAGG + Intergenic
1049287907 8:141786558-141786580 ATGGGGAGGCTTCAGGGTGTGGG + Intergenic
1049421181 8:142517350-142517372 CTGGGGTGTCATCCGGGTGCCGG - Intronic
1049604608 8:143523497-143523519 CTGAGGTGGCTTCCGTCTGTAGG - Intronic
1049615757 8:143575230-143575252 CTGGGCTGGCCTCACGGTGCAGG + Exonic
1049642735 8:143722701-143722723 CTGCTGTGGCTTCAGGGTCCAGG + Intergenic
1049716525 8:144095532-144095554 CTGGGGTCACTTCAGGACGCGGG - Intronic
1049791778 8:144475583-144475605 CTGGGCCAGCTTCAGTCTGCGGG + Exonic
1049822835 8:144646549-144646571 CTGGGGTGGGCACAGGCTGGCGG + Intergenic
1050237571 9:3597840-3597862 ATGGGGTGGCTTCCCTCTGCTGG - Intergenic
1050585783 9:7109995-7110017 CTGGGGAGGCCTCAGGCAGAAGG - Intergenic
1050976085 9:11940368-11940390 CTGGGCTGGATGCAGCCTGCAGG + Intergenic
1053169407 9:35868068-35868090 ATGGGGTGGCTTCAGGCTTTGGG + Intergenic
1053520132 9:38769079-38769101 CTGGGGAGGCCCCAGGCTGTGGG - Intergenic
1054199297 9:62065565-62065587 TTGGCTTGGCTCCAGGCTGCAGG + Intergenic
1056299935 9:85230371-85230393 CTGGGTTTGCTCCAGGCTGCTGG - Intergenic
1057223191 9:93268724-93268746 CTTGGCTGGCTTCTGGCGGCAGG - Exonic
1057311288 9:93944919-93944941 CTGGGCTCCCTTCAGGCTCCAGG + Intergenic
1057549199 9:96039654-96039676 TTGGGGTGGCTTGACCCTGCAGG + Intergenic
1057568656 9:96186771-96186793 CTGGGCCGGCTGCGGGCTGCAGG - Intergenic
1060376818 9:123122648-123122670 CTTGTGTTTCTTCAGGCTGCAGG - Exonic
1060595203 9:124843620-124843642 CTGGGGTGGATCGAGGGTGCAGG - Intergenic
1060965770 9:127711628-127711650 CTGTGGGGGCTGCAGGGTGCTGG + Intronic
1061054573 9:128215575-128215597 CTGGGGAGGCAGCAGGCAGCTGG + Intronic
1061074387 9:128332315-128332337 CTGGGGTGGCTTCAGGGCCAGGG + Intronic
1061146962 9:128805714-128805736 CAGGGCTGGCACCAGGCTGCCGG - Intronic
1061212166 9:129200068-129200090 CTGGGCCGGCTAGAGGCTGCTGG - Intergenic
1061241287 9:129374701-129374723 CTGGGGAGGCTTGAGGCAGGAGG - Intergenic
1061665677 9:132159896-132159918 CTGGGGTGACAGCAGGCTGAGGG + Intergenic
1061860707 9:133467357-133467379 ATGGGAGGGCTGCAGGCTGCGGG - Intronic
1061904820 9:133691249-133691271 CTGGGATGGCTGCAGACTGGGGG - Intronic
1062286930 9:135777558-135777580 TTGGGGAGGCTGCTGGCTGCAGG - Intronic
1062460390 9:136660365-136660387 CTGTGGTGGCTCCAGGCTATGGG + Intronic
1185730963 X:2461363-2461385 CTGAGGTGGCTTTTGGCTGACGG - Intronic
1185733902 X:2482907-2482929 CTGAGGTGGCTTTTGGCTGACGG - Intronic
1185762090 X:2696340-2696362 CTGGTGTAGCTGCAGGCTGCAGG + Intronic
1188468183 X:30506789-30506811 GTTGAGTGGCTTCAAGCTGCAGG + Intergenic
1189292505 X:39896130-39896152 CAGGACTGGCCTCAGGCTGCAGG + Intergenic
1190874276 X:54448827-54448849 CTGGGGTGTATGCTGGCTGCAGG + Exonic
1194394992 X:93372597-93372619 CTTGGGTGGCTACAGTATGCTGG + Intergenic
1198585271 X:138113881-138113903 CTGGGGTCTCTAAAGGCTGCTGG - Intergenic
1200244788 X:154517187-154517209 CTGGGGTGGTCTCCGGCCGCAGG + Intergenic
1200358594 X:155578265-155578287 CAGGGTTGTCTCCAGGCTGCCGG - Intronic
1200954630 Y:8931003-8931025 GTGGGTTGGCATCAGGCTTCTGG - Intergenic
1202370703 Y:24193605-24193627 CTGTGGTGGCTCCATCCTGCAGG - Intergenic
1202500081 Y:25476512-25476534 CTGTGGTGGCTCCATCCTGCAGG + Intergenic