ID: 1142866468

View in Genome Browser
Species Human (GRCh38)
Location 17:2794502-2794524
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 95}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142866468_1142866481 10 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866481 17:2794535-2794557 GGGGCAGAGGTGAGGGTTGGGGG 0: 1
1: 1
2: 18
3: 164
4: 1348
1142866468_1142866475 2 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866475 17:2794527-2794549 ACTTTCCTGGGGCAGAGGTGAGG 0: 1
1: 0
2: 2
3: 53
4: 409
1142866468_1142866480 9 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866480 17:2794534-2794556 TGGGGCAGAGGTGAGGGTTGGGG 0: 1
1: 1
2: 10
3: 141
4: 1170
1142866468_1142866483 21 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866483 17:2794546-2794568 GAGGGTTGGGGGAAGCCTCCGGG 0: 1
1: 0
2: 4
3: 24
4: 350
1142866468_1142866476 3 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866476 17:2794528-2794550 CTTTCCTGGGGCAGAGGTGAGGG 0: 1
1: 0
2: 1
3: 51
4: 447
1142866468_1142866482 20 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866482 17:2794545-2794567 TGAGGGTTGGGGGAAGCCTCCGG 0: 1
1: 0
2: 6
3: 41
4: 350
1142866468_1142866471 -10 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151
1142866468_1142866472 -9 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866472 17:2794516-2794538 ACACAATCCTAACTTTCCTGGGG 0: 1
1: 0
2: 2
3: 36
4: 524
1142866468_1142866473 -3 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866473 17:2794522-2794544 TCCTAACTTTCCTGGGGCAGAGG 0: 1
1: 0
2: 3
3: 17
4: 263
1142866468_1142866479 8 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866479 17:2794533-2794555 CTGGGGCAGAGGTGAGGGTTGGG 0: 1
1: 2
2: 12
3: 93
4: 810
1142866468_1142866478 7 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866478 17:2794532-2794554 CCTGGGGCAGAGGTGAGGGTTGG 0: 1
1: 2
2: 20
3: 122
4: 963

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142866468 Original CRISPR GGATTGTGTGGTTCATGCTC TGG (reversed) Intronic