ID: 1142866469

View in Genome Browser
Species Human (GRCh38)
Location 17:2794514-2794536
Sequence CCAGGAAAGTTAGGATTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 148}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142866469_1142866480 -3 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866480 17:2794534-2794556 TGGGGCAGAGGTGAGGGTTGGGG 0: 1
1: 1
2: 10
3: 141
4: 1170
1142866469_1142866479 -4 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866479 17:2794533-2794555 CTGGGGCAGAGGTGAGGGTTGGG 0: 1
1: 2
2: 12
3: 93
4: 810
1142866469_1142866486 21 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866486 17:2794558-2794580 AAGCCTCCGGGCTCCTGCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 214
1142866469_1142866481 -2 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866481 17:2794535-2794557 GGGGCAGAGGTGAGGGTTGGGGG 0: 1
1: 1
2: 18
3: 164
4: 1348
1142866469_1142866478 -5 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866478 17:2794532-2794554 CCTGGGGCAGAGGTGAGGGTTGG 0: 1
1: 2
2: 20
3: 122
4: 963
1142866469_1142866484 19 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866484 17:2794556-2794578 GGAAGCCTCCGGGCTCCTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 235
1142866469_1142866476 -9 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866476 17:2794528-2794550 CTTTCCTGGGGCAGAGGTGAGGG 0: 1
1: 0
2: 1
3: 51
4: 447
1142866469_1142866475 -10 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866475 17:2794527-2794549 ACTTTCCTGGGGCAGAGGTGAGG 0: 1
1: 0
2: 2
3: 53
4: 409
1142866469_1142866483 9 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866483 17:2794546-2794568 GAGGGTTGGGGGAAGCCTCCGGG 0: 1
1: 0
2: 4
3: 24
4: 350
1142866469_1142866482 8 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866482 17:2794545-2794567 TGAGGGTTGGGGGAAGCCTCCGG 0: 1
1: 0
2: 6
3: 41
4: 350
1142866469_1142866485 20 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866485 17:2794557-2794579 GAAGCCTCCGGGCTCCTGCTGGG 0: 1
1: 0
2: 2
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142866469 Original CRISPR CCAGGAAAGTTAGGATTGTG TGG (reversed) Intronic