ID: 1142866470

View in Genome Browser
Species Human (GRCh38)
Location 17:2794514-2794536
Sequence CCACACAATCCTAACTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142866461_1142866470 23 Left 1142866461 17:2794468-2794490 CCATCCTGTGGGAAGCCAGCAGC 0: 1
1: 0
2: 4
3: 35
4: 282
Right 1142866470 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 120
1142866462_1142866470 19 Left 1142866462 17:2794472-2794494 CCTGTGGGAAGCCAGCAGCCTGA 0: 1
1: 0
2: 3
3: 29
4: 236
Right 1142866470 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 120
1142866465_1142866470 -6 Left 1142866465 17:2794497-2794519 CCACCCCAGAGCATGAACCACAC 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1142866470 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 120
1142866466_1142866470 -9 Left 1142866466 17:2794500-2794522 CCCCAGAGCATGAACCACACAAT 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1142866470 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 120
1142866464_1142866470 1 Left 1142866464 17:2794490-2794512 CCTGAAGCCACCCCAGAGCATGA 0: 1
1: 0
2: 1
3: 21
4: 304
Right 1142866470 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 120
1142866463_1142866470 8 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866470 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 120
1142866467_1142866470 -10 Left 1142866467 17:2794501-2794523 CCCAGAGCATGAACCACACAATC 0: 1
1: 1
2: 0
3: 10
4: 122
Right 1142866470 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142866470 Original CRISPR CCACACAATCCTAACTTTCC TGG Intronic