ID: 1142866471

View in Genome Browser
Species Human (GRCh38)
Location 17:2794515-2794537
Sequence CACACAATCCTAACTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 151}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142866463_1142866471 9 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151
1142866462_1142866471 20 Left 1142866462 17:2794472-2794494 CCTGTGGGAAGCCAGCAGCCTGA 0: 1
1: 0
2: 3
3: 29
4: 236
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151
1142866466_1142866471 -8 Left 1142866466 17:2794500-2794522 CCCCAGAGCATGAACCACACAAT 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151
1142866468_1142866471 -10 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151
1142866467_1142866471 -9 Left 1142866467 17:2794501-2794523 CCCAGAGCATGAACCACACAATC 0: 1
1: 1
2: 0
3: 10
4: 122
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151
1142866464_1142866471 2 Left 1142866464 17:2794490-2794512 CCTGAAGCCACCCCAGAGCATGA 0: 1
1: 0
2: 1
3: 21
4: 304
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151
1142866465_1142866471 -5 Left 1142866465 17:2794497-2794519 CCACCCCAGAGCATGAACCACAC 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151
1142866461_1142866471 24 Left 1142866461 17:2794468-2794490 CCATCCTGTGGGAAGCCAGCAGC 0: 1
1: 0
2: 4
3: 35
4: 282
Right 1142866471 17:2794515-2794537 CACACAATCCTAACTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142866471 Original CRISPR CACACAATCCTAACTTTCCT GGG Intronic