ID: 1142866480

View in Genome Browser
Species Human (GRCh38)
Location 17:2794534-2794556
Sequence TGGGGCAGAGGTGAGGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1323
Summary {0: 1, 1: 1, 2: 10, 3: 141, 4: 1170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142866466_1142866480 11 Left 1142866466 17:2794500-2794522 CCCCAGAGCATGAACCACACAAT 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1142866480 17:2794534-2794556 TGGGGCAGAGGTGAGGGTTGGGG 0: 1
1: 1
2: 10
3: 141
4: 1170
1142866469_1142866480 -3 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866480 17:2794534-2794556 TGGGGCAGAGGTGAGGGTTGGGG 0: 1
1: 1
2: 10
3: 141
4: 1170
1142866467_1142866480 10 Left 1142866467 17:2794501-2794523 CCCAGAGCATGAACCACACAATC 0: 1
1: 1
2: 0
3: 10
4: 122
Right 1142866480 17:2794534-2794556 TGGGGCAGAGGTGAGGGTTGGGG 0: 1
1: 1
2: 10
3: 141
4: 1170
1142866468_1142866480 9 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866480 17:2794534-2794556 TGGGGCAGAGGTGAGGGTTGGGG 0: 1
1: 1
2: 10
3: 141
4: 1170
1142866465_1142866480 14 Left 1142866465 17:2794497-2794519 CCACCCCAGAGCATGAACCACAC 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1142866480 17:2794534-2794556 TGGGGCAGAGGTGAGGGTTGGGG 0: 1
1: 1
2: 10
3: 141
4: 1170
1142866463_1142866480 28 Left 1142866463 17:2794483-2794505 CCAGCAGCCTGAAGCCACCCCAG 0: 1
1: 0
2: 3
3: 35
4: 404
Right 1142866480 17:2794534-2794556 TGGGGCAGAGGTGAGGGTTGGGG 0: 1
1: 1
2: 10
3: 141
4: 1170
1142866464_1142866480 21 Left 1142866464 17:2794490-2794512 CCTGAAGCCACCCCAGAGCATGA 0: 1
1: 0
2: 1
3: 21
4: 304
Right 1142866480 17:2794534-2794556 TGGGGCAGAGGTGAGGGTTGGGG 0: 1
1: 1
2: 10
3: 141
4: 1170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142866480 Original CRISPR TGGGGCAGAGGTGAGGGTTG GGG Intronic