ID: 1142866482

View in Genome Browser
Species Human (GRCh38)
Location 17:2794545-2794567
Sequence TGAGGGTTGGGGGAAGCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 350}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142866466_1142866482 22 Left 1142866466 17:2794500-2794522 CCCCAGAGCATGAACCACACAAT 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1142866482 17:2794545-2794567 TGAGGGTTGGGGGAAGCCTCCGG 0: 1
1: 0
2: 6
3: 41
4: 350
1142866477_1142866482 -10 Left 1142866477 17:2794532-2794554 CCTGGGGCAGAGGTGAGGGTTGG 0: 1
1: 0
2: 9
3: 76
4: 608
Right 1142866482 17:2794545-2794567 TGAGGGTTGGGGGAAGCCTCCGG 0: 1
1: 0
2: 6
3: 41
4: 350
1142866465_1142866482 25 Left 1142866465 17:2794497-2794519 CCACCCCAGAGCATGAACCACAC 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1142866482 17:2794545-2794567 TGAGGGTTGGGGGAAGCCTCCGG 0: 1
1: 0
2: 6
3: 41
4: 350
1142866474_1142866482 -1 Left 1142866474 17:2794523-2794545 CCTAACTTTCCTGGGGCAGAGGT 0: 1
1: 0
2: 0
3: 18
4: 209
Right 1142866482 17:2794545-2794567 TGAGGGTTGGGGGAAGCCTCCGG 0: 1
1: 0
2: 6
3: 41
4: 350
1142866468_1142866482 20 Left 1142866468 17:2794502-2794524 CCAGAGCATGAACCACACAATCC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1142866482 17:2794545-2794567 TGAGGGTTGGGGGAAGCCTCCGG 0: 1
1: 0
2: 6
3: 41
4: 350
1142866467_1142866482 21 Left 1142866467 17:2794501-2794523 CCCAGAGCATGAACCACACAATC 0: 1
1: 1
2: 0
3: 10
4: 122
Right 1142866482 17:2794545-2794567 TGAGGGTTGGGGGAAGCCTCCGG 0: 1
1: 0
2: 6
3: 41
4: 350
1142866469_1142866482 8 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866482 17:2794545-2794567 TGAGGGTTGGGGGAAGCCTCCGG 0: 1
1: 0
2: 6
3: 41
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142866482 Original CRISPR TGAGGGTTGGGGGAAGCCTC CGG Intronic