ID: 1142866484

View in Genome Browser
Species Human (GRCh38)
Location 17:2794556-2794578
Sequence GGAAGCCTCCGGGCTCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142866469_1142866484 19 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866484 17:2794556-2794578 GGAAGCCTCCGGGCTCCTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 235
1142866477_1142866484 1 Left 1142866477 17:2794532-2794554 CCTGGGGCAGAGGTGAGGGTTGG 0: 1
1: 0
2: 9
3: 76
4: 608
Right 1142866484 17:2794556-2794578 GGAAGCCTCCGGGCTCCTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 235
1142866474_1142866484 10 Left 1142866474 17:2794523-2794545 CCTAACTTTCCTGGGGCAGAGGT 0: 1
1: 0
2: 0
3: 18
4: 209
Right 1142866484 17:2794556-2794578 GGAAGCCTCCGGGCTCCTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142866484 Original CRISPR GGAAGCCTCCGGGCTCCTGC TGG Intronic